Miyakogusa Predicted Gene

Lj6g3v1879890.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1879890.1 Non Chatacterized Hit- tr|I1MFG0|I1MFG0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.26420
PE,76.73,0,PROTEIN_KINASE_DOM,Protein kinase, catalytic domain;
PROTEIN_KINASE_ATP,Protein kinase, ATP binding ,CUFF.60029.1
         (1167 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV767377 similar to UniRef100_A7P231 Cluster: Chromosom...    74   2e-12
gnl|LJGI|TC82296                                                       68   1e-10
gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinas...    56   5e-07
gnl|LJGI|TC76548 similar to UniRef100_A7PST8 Cluster: Chromosome...    52   8e-06

>gnl|LJGI|AV767377 similar to UniRef100_A7P231 Cluster: Chromosome chr19 scaffold_4,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr19 scaffold_4, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (24%)
          Length = 444

 Score = 73.8 bits (37), Expect = 2e-12
 Identities = 174/218 (79%), Gaps = 5/218 (2%)
 Strand = Plus / Plus

                                                                       
Query: 581 accccccagtgatattccgtgatttcaagtcgtcaaatatacttttagatgaagatttca 640
           |||| |||||||||| ||| ||||| ||  | ||||| ||||| |||||||| || ||||
Sbjct: 230 acccgccagtgatataccgcgattttaaagcatcaaacatactgttagatgacgacttca 289

                                                                       
Query: 641 acccaaagctctctgattttggacttgcaaagattgctccagcagaggggttccagaac- 699
           | |||||||| | |||||||||||| |||||| ||| |||| | | ||     || ||| 
Sbjct: 290 atccaaagctttttgattttggactcgcaaagcttggtccaactgggg----acaaaaca 345

                                                                       
Query: 700 catgtctcaaccagggtgatggggacctatggctactgtgcaccagagtatgctgcaaca 759
           ||||| || ||||| | |||||| || |||||||| || || || ||||||||  |||||
Sbjct: 346 catgtatccaccagagggatgggaacttatggctattgggctcctgagtatgcatcaaca 405

                                                 
Query: 760 ggtcaattaacatcaaaatcagatatttatagttttgg 797
           || ||||||||| ||||||||||| | ||||| |||||
Sbjct: 406 gggcaattaacaacaaaatcagatgtgtatagctttgg 443


>gnl|LJGI|TC82296 
          Length = 1729

 Score = 67.9 bits (34), Expect = 1e-10
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                  
Query: 700  catgtctcaaccagggtgatggggacctatggctactgtgcaccagagtatgct 753
            ||||| |||||||| |||||||| || |||||||||||||| ||||||||||||
Sbjct: 1149 catgtttcaaccagagtgatgggtacatatggctactgtgctccagagtatgct 1202


>gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinase-like protein; n=1;
           Glycine max|Rep: Pti1 kinase-like protein - Glycine max
           (Soybean), complete
          Length = 1554

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 529 aaaattgctgagggagcagctagaggacttgaatatctgcatga 572
           ||||||||||  |||||||| ||||||||||||||||| |||||
Sbjct: 694 aaaattgctgttggagcagccagaggacttgaatatctccatga 737


>gnl|LJGI|TC76548 similar to UniRef100_A7PST8 Cluster: Chromosome chr8 scaffold_29,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr8 scaffold_29, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (29%)
          Length = 653

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                         
Query: 404 ttggttattgtgcagaaggtgatcaaagggttttagtctatgaata 449
           ||||||||||||| || |||||||||||| || |||| ||||||||
Sbjct: 588 ttggttattgtgctgatggtgatcaaaggcttctagtttatgaata 633