Miyakogusa Predicted Gene

Lj6g3v1732740.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1732740.1 Non Chatacterized Hit- tr|I1JLP3|I1JLP3_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,58.57,0.000000000000006,Chromo,Chromo domain; CHROMO_2,Chromo
domain/shadow; no description,NULL; Chromo domain-like,Chromo
,CUFF.59850.1
         (216 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO040426 similar to UniRef100_A7BS46 Cluster: Transposa...    50   5e-06

>gnl|LJGI|GO040426 similar to UniRef100_A7BS46 Cluster: Transposase, IS4; n=1;
           Beggiatoa sp. PS|Rep: Transposase, IS4 - Beggiatoa sp.
           PS, partial (8%)
          Length = 787

 Score = 50.1 bits (25), Expect = 5e-06
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 165 tcaccttgaggacaaggtgaatctt 189
           |||||||||||||||||||||||||
Sbjct: 318 tcaccttgaggacaaggtgaatctt 294