Miyakogusa Predicted Gene
- Lj6g3v1693850.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1693850.1 Non Chatacterized Hit- tr|G7ISR7|G7ISR7_MEDTR
Putative uncharacterized protein OS=Medicago
truncatul,80.49,0.000000002,
,NODE_106114_length_96_cov_17.791666.path2.1
(124 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC80113 similar to UniRef100_Q107V4 Cluster: ATPase sub... 246 2e-65
gnl|LJGI|TC62650 UniRef100_P12347 Cluster: Period clock protein;... 198 5e-51
>gnl|LJGI|TC80113 similar to UniRef100_Q107V4 Cluster: ATPase subunit 6; n=1;
Nesomimus melanotis|Rep: ATPase subunit 6 - Nesomimus
melanotis (San Cristobal mockingbird), partial (8%)
Length = 671
Score = 246 bits (124), Expect = 2e-65
Identities = 124/124 (100%)
Strand = Plus / Minus
Query: 1 atgaacactaggattgcaaatgaatccagtgaggactatatatttagcccagagctggca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 670 atgaacactaggattgcaaatgaatccagtgaggactatatatttagcccagagctggca 611
Query: 61 tctgcctttgagcagtgcatgcaaaatcttgatgcagaggaagaaaagattctgaaacaa 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 610 tctgcctttgagcagtgcatgcaaaatcttgatgcagaggaagaaaagattctgaaacaa 551
Query: 121 attt 124
||||
Sbjct: 550 attt 547
>gnl|LJGI|TC62650 UniRef100_P12347 Cluster: Period clock protein; n=1; Acetabularia
acetabulum|Rep: Period clock protein - Acetabularia
acetabulum (Mermaid's wine glass)
(Acetabulariamediterranea), partial (8%)
Length = 1600
Score = 198 bits (100), Expect = 5e-51
Identities = 118/124 (95%)
Strand = Plus / Plus
Query: 1 atgaacactaggattgcaaatgaatccagtgaggactatatatttagcccagagctggca 60
|||||||||||||||||||||||||||||| |||| | |||||||||||||||||||| |
Sbjct: 1179 atgaacactaggattgcaaatgaatccagtcaggaatctatatttagcccagagctggta 1238
Query: 61 tctgcctttgagcagtgcatgcaaaatcttgatgcagaggaagaaaagattctgaaacaa 120
||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 1239 tctgcctttgaacagtgcatgcaaaatcttgatgcagaggaagaaaagattttgaaacaa 1298
Query: 121 attt 124
||||
Sbjct: 1299 attt 1302