Miyakogusa Predicted Gene

Lj6g3v1693480.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1693480.1 NODE_43168_length_1572_cov_9.791348.path2.1
         (1446 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57745 similar to UniRef100_O49621 Cluster: MLO-like p...    54   3e-06

>gnl|LJGI|TC57745 similar to UniRef100_O49621 Cluster: MLO-like protein 1; n=1;
            Arabidopsis thaliana|Rep: MLO-like protein 1 -
            Arabidopsis thaliana (Mouse-ear cress), partial (78%)
          Length = 2029

 Score = 54.0 bits (27), Expect = 3e-06
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 1108 ttctggatttggagcacatatggatttgattcatgcattatgg 1150
            ||||||||||||  |||||||||||||||||| ||||| ||||
Sbjct: 1349 ttctggatttgggtcacatatggatttgattcctgcataatgg 1391