Miyakogusa Predicted Gene
- Lj6g3v1692520.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1692520.1 tr|G7IFV9|G7IFV9_MEDTR Protein argonaute
OS=Medicago truncatula GN=MTR_2g028910 PE=4 SV=1,76.4,0,seg,NULL;
SUBFAMILY NOT NAMED,NULL; EUKARYOTIC TRANSLATION INITIATION FACTOR
2C,NULL; Ribonuclease H,CUFF.59795.1
(2997 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC74652 82 2e-14
gnl|LJGI|BW598563 weakly similar to UniRef100_A7QM22 Cluster: Ch... 68 3e-10
>gnl|LJGI|TC74652
Length = 550
Score = 81.8 bits (41), Expect = 2e-14
Identities = 47/49 (95%)
Strand = Plus / Plus
Query: 2831 tgtactatgctgatcttgctgcttatagaggacggctataccatgaagc 2879
|||||||||||||||||||||||||||||||||| |||||| |||||||
Sbjct: 1 tgtactatgctgatcttgctgcttatagaggacgactatactatgaagc 49
>gnl|LJGI|BW598563 weakly similar to UniRef100_A7QM22 Cluster: Chromosome undetermined
scaffold_123, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome undetermined scaffold_123, whole
genome shotgun sequence - Vitis vinifera (Grape), partial
(8%)
Length = 347
Score = 67.9 bits (34), Expect = 3e-10
Identities = 118/146 (80%)
Strand = Plus / Plus
Query: 2017 aagtacctcaagtggatttctgagaccaaaattggtatagtgacacaatgctgcttgtcc 2076
|||| ||||||||||||| |||||||||| |||| || |||||||||||||||| ||
Sbjct: 157 aagtgcctcaagtggattgctgagaccaaggttggcttaatgacacaatgctgcttatct 216
Query: 2077 agtagtgctaatgaaggcgaggataaattttatactaatttggctctcaagatcaatgcc 2136
||| |||||||||||| | ||| | |||||| |||||||||| ||||||||
Sbjct: 217 ggtaatgctaatgaaggatcataccaatatctcactaatctggctctcaaaatcaatgca 276
Query: 2137 aagcttggaggcagtaatgtggagct 2162
|| ||||||||| ||||||||||||
Sbjct: 277 aaaattggaggcactaatgtggagct 302