Miyakogusa Predicted Gene

Lj6g3v1640140.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1640140.1 Non Chatacterized Hit- tr|F6HRT7|F6HRT7_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,28.62,0.000000000007,OS09G0311600 PROTEIN,NULL; LEUCINE-RICH
REPEAT-CONTAINING PROTEIN,NULL; LRR_7,NULL;
LRR_1,Leucine-ri,CUFF.59728.1
         (1026 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BW622909 weakly similar to UniRef100_Q2YE87 Cluster: NB...   363   1e-99
gnl|LJGI|TC80664 weakly similar to UniRef100_Q2YE88 Cluster: NBS...   143   2e-33
gnl|LJGI|BP066885 weakly similar to UniRef100_A2Q526 Cluster: Le...    92   8e-18
gnl|LJGI|BW595042 weakly similar to UniRef100_A2Q529 Cluster: Le...    54   2e-06

>gnl|LJGI|BW622909 weakly similar to UniRef100_Q2YE87 Cluster: NBS-LRR type disease
           resistance protein Rps1-k-2; n=1; Glycine max|Rep:
           NBS-LRR type disease resistance protein Rps1-k-2 -
           Glycine max (Soybean), partial (12%)
          Length = 476

 Score =  363 bits (183), Expect = 1e-99
 Identities = 359/421 (85%), Gaps = 15/421 (3%)
 Strand = Plus / Plus

                                                                       
Query: 61  tacaggggcactaaattcccagaatgggttggacattcttcctaccacaacatgactgag 120
           |||| |||||| |||||  || |||||||||||| ||||||||||||||||||||||   
Sbjct: 6   tacatgggcacaaaatttacaaaatgggttggacgttcttcctaccacaacatgacttca 65

                                                                       
Query: 121 ctatatctatgggattgtatgaattgttgtatgcttccttcacttggacaactaccctct 180
            ||| |||||  ||||||| ||| || || ||||||||||||||||||||||| ||||||
Sbjct: 66  atatgtctatctgattgtaagaactgctgcatgcttccttcacttggacaactgccctct 125

                                                                       
Query: 181 ctcaagacactatatattatccgattgaacggg---------------gttgaatttttg 225
           ||||||||||||||||||  || ||||||||||               ||||||||||||
Sbjct: 126 ctcaagacactatatatttgccaattgaacgggttggagactgttggtgttgaatttttg 185

                                                                       
Query: 226 aagagcgacgattccttttcagggacaccttttccctcccttcacaatctgacatttata 285
           |||||||| || ||||||||||||||| ||||||||||||| ||   ||||||||||  |
Sbjct: 186 aagagcgatgaatccttttcagggacatcttttccctccctacaatctctgacatttgaa 245

                                                                       
Query: 286 gacatgccgagttgggaggtgtggcgtccctttgaatcaaatgcctttcctcaactacag 345
           ||||||||||||||||||||||||||||| || ||||||||||| |||||||||||| ||
Sbjct: 246 gacatgccgagttgggaggtgtggcgtccattcgaatcaaatgcttttcctcaactaaag 305

                                                                       
Query: 346 tacctcagaatagacaactgtcccagattaaggggagatttgccaaataaccttccagct 405
            | |||  ||||  | | ||||||||||||||||||||||||||| |||||||||| |||
Sbjct: 306 aagctctcaataagctattgtcccagattaaggggagatttgccatataaccttccggct 365

                                                                       
Query: 406 ttggaatcacttgaaattagcagatgtgagcagcttgcttcttctcttccaagggctcct 465
           |||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||||
Sbjct: 366 ttggaatcacttgatattagcagttgtgagcagcttgtttcttctcttccaagggctcct 425

            
Query: 466 g 466
           |
Sbjct: 426 g 426


>gnl|LJGI|TC80664 weakly similar to UniRef100_Q2YE88 Cluster: NBS-LRR type disease
            resistance protein Rps1-k-1; n=1; Glycine max|Rep:
            NBS-LRR type disease resistance protein Rps1-k-1 -
            Glycine max (Soybean), partial (21%)
          Length = 1338

 Score =  143 bits (72), Expect = 2e-33
 Identities = 223/271 (82%), Gaps = 8/271 (2%)
 Strand = Plus / Plus

                                                                        
Query: 763  agctgtgattctctcacatccctcctgttggagagctttccaaatctccattctctcacg 822
            |||||||||||||||| |||||| | |||||||| |||||||||||||| ||||||||| 
Sbjct: 617  agctgtgattctctcatatcccttcagttggagacctttccaaatctccgttctctcacc 676

                                                                        
Query: 823  atcagaaaccttgaaaatctggaaagtatttcagtac---agggagatgctgc----tct 875
            |||| ||||  || |||||||||| ||||||||||||   | | || | || |    |||
Sbjct: 677  atcataaactgtgcaaatctggaacgtatttcagtaccgaatgcaggt-cttcacaatct 735

                                                                        
Query: 876  cacagatttcgtcatagatggctgccccaaatttgtatcattcccaaatgaaggattgtc 935
            ||||  |||||  ||| ||| ||||||||||||||||||||||||||  |||||||||  
Sbjct: 736  cacatctttcgagataaatgactgccccaaatttgtatcattcccaatagaaggattgca 795

                                                                        
Query: 936  tgcgcctgcaatgactaaattctctgtctctgattgcaacaagttaaagtcattacctta 995
            ||||||     ||||| || ||   |||||| ||||| || |||||||||||||||||| 
Sbjct: 796  tgcgcccaacttgactgaaatcgacgtctcttattgcgacgagttaaagtcattaccttg 855

                                           
Query: 996  tcacatgagtactcttctcccaaagttagaa 1026
            |||||||| ||||||||||||||||||||||
Sbjct: 856  tcacatgaatactcttctcccaaagttagaa 886



 Score = 89.7 bits (45), Expect = 3e-17
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                       
Query: 317 ttgaatcaaatgcctttcctcaactacagtacctcagaatagacaactgtcccagattaa 376
           |||| ||||||||||||||||||||| ||  |||||  |||    | |||||||||||||
Sbjct: 150 ttgagtcaaatgcctttcctcaactaaagcgcctcaccataagtgattgtcccagattaa 209

                                                    
Query: 377 ggggagatttgccaaataaccttccagctttggaatcactt 417
           ||||||||||||||| | | |||||||||||||||||||||
Sbjct: 210 ggggagatttgccaactcatcttccagctttggaatcactt 250


>gnl|LJGI|BP066885 weakly similar to UniRef100_A2Q526 Cluster: Leucine Rich Repeat
           family protein; n=1; Medicago truncatula|Rep: Leucine
           Rich Repeat family protein - Medicago truncatula (Barrel
           medic), partial (12%)
          Length = 469

 Score = 91.7 bits (46), Expect = 8e-18
 Identities = 166/206 (80%)
 Strand = Plus / Minus

                                                                       
Query: 520 cccatttcggtggaagatctatatatcaaaggaagcgaggtggtggattccatgttggag 579
           ||||||||||||||||| ||| | |||| ||||||||||| |||||| |  ||||| |||
Sbjct: 469 cccatttcggtggaagagctagaaatcagaggaagcgaggcggtggagtttatgtttgag 410

                                                                       
Query: 580 accaccgccatcacccaaccaacttcccttagatctttatctttagggaattgttcagct 639
            ||| | ||||||||| ||| ||||  |||  |  ||||    |  ||| ||||||| ||
Sbjct: 409 gccatcaccatcaccccacccacttgtcttcaaggtttaatgatctggagttgttcatct 350

                                                                       
Query: 640 gtcagatcattcccgggagattgtttacctgcatcactgaagaacttgcgtatcaaggat 699
           | |  |||||||||||||||||||||||| |||||||| |||| ||||  ||||  ||||
Sbjct: 349 gccttatcattcccgggagattgtttacccgcatcactcaagagcttgtatatccgggat 290

                                     
Query: 700 ttcaggaagctagaatttccaaagca 725
           |||||| | |||||||||||||||||
Sbjct: 289 ttcagggaactagaatttccaaagca 264


>gnl|LJGI|BW595042 weakly similar to UniRef100_A2Q529 Cluster: Leucine-rich repeat; n=1;
            Medicago truncatula|Rep: Leucine-rich repeat - Medicago
            truncatula (Barrel medic), partial (19%)
          Length = 486

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 57/67 (85%)
 Strand = Plus / Plus

                                                                        
Query: 953  aattctctgtctctgattgcaacaagttaaagtcattaccttatcacatgagtactcttc 1012
            ||||||| || ||||||||| |||||||| ||||||| |||  ||  |||| ||||||||
Sbjct: 395  aattctccgtttctgattgcgacaagttagagtcattgcctcgtcggatgaatactcttc 454

                   
Query: 1013 tcccaaa 1019
            |||||||
Sbjct: 455  tcccaaa 461