Miyakogusa Predicted Gene

Lj6g3v1629780.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1629780.1 Non Chatacterized Hit- tr|I1L0G0|I1L0G0_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.37314
PE,73.02,0,seg,NULL; HELICASE-RELATED,NULL; P-loop containing
nucleoside triphosphate hydrolases,NULL;
helicase,NODE_62166_length_1516_cov_48.048813.path1.1
         (1512 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|DC594538 similar to UniRef100_Q1KL58 Cluster: Dicer-lik...    84   3e-15

>gnl|LJGI|DC594538 similar to UniRef100_Q1KL58 Cluster: Dicer-like 2 spliceform 1;
           n=1; Arabidopsis thaliana|Rep: Dicer-like 2 spliceform 1
           - Arabidopsis thaliana (Mouse-ear cress), partial (4%)
          Length = 317

 Score = 83.8 bits (42), Expect = 3e-15
 Identities = 42/42 (100%)
 Strand = Plus / Plus

                                                     
Query: 1   atgcttcttcgcagctatgcatatagactgcgaaagccttct 42
           ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 276 atgcttcttcgcagctatgcatatagactgcgaaagccttct 317