Miyakogusa Predicted Gene
- Lj6g3v1618130.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1618130.1 tr|G7LEZ2|G7LEZ2_MEDTR Telomeric repeat-binding
factor OS=Medicago truncatula GN=MTR_8g094390 PE=4
S,52.27,0.16,seg,NULL; "Winged helix" DNA-binding domain,NULL;
Homeodomain-like,Homeodomain-like; TELOMERIC REPEA,CUFF.59718.1
(903 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59841 similar to UniRef100_Q0PJL7 Cluster: MYB transc... 1453 0.0
gnl|LJGI|TC78026 similar to UniRef100_Q0PJL7 Cluster: MYB transc... 414 e-115
gnl|LJGI|TC62575 similar to UniRef100_Q0PJK3 Cluster: MYB transc... 62 6e-09
gnl|LJGI|TC74646 similar to UniRef100_Q0PJG6 Cluster: MYB transc... 56 4e-07
>gnl|LJGI|TC59841 similar to UniRef100_Q0PJL7 Cluster: MYB transcription factor
MYB55; n=1; Glycine max|Rep: MYB transcription factor
MYB55 - Glycine max (Soybean), partial (81%)
Length = 1012
Score = 1453 bits (733), Expect = 0.0
Identities = 733/733 (100%)
Strand = Plus / Plus
Query: 1 atgggtgctcccaagcaaaaatggactgctgaagaggaagcagcacttaaagctggggtg 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 151 atgggtgctcccaagcaaaaatggactgctgaagaggaagcagcacttaaagctggggtg 210
Query: 61 gtcaagcatggagttggtaaatggcgtacgatactcaaggatccggagtataacagtgtc 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 211 gtcaagcatggagttggtaaatggcgtacgatactcaaggatccggagtataacagtgtc 270
Query: 121 ttatatctgcggtcgaatgtggatctcaaggataaatggaggaatctgagtgtgatggca 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 271 ttatatctgcggtcgaatgtggatctcaaggataaatggaggaatctgagtgtgatggca 330
Query: 181 aatggatggacctccagggaaaagtctaggttgtcagtcagaagggtgcatcagaacgca 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 331 aatggatggacctccagggaaaagtctaggttgtcagtcagaagggtgcatcagaacgca 390
Query: 241 aaacaggacgacaactctatggctgtcactgttgttccaagtgatgaagaaattgttgat 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 391 aaacaggacgacaactctatggctgtcactgttgttccaagtgatgaagaaattgttgat 450
Query: 301 gttaagcctcttcaagtttcaagagatatggttcaggttcctggtccaaaaaagtctatt 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 451 gttaagcctcttcaagtttcaagagatatggttcaggttcctggtccaaaaaagtctatt 510
Query: 361 gtaaggttggataaccttatactggaagcaataactagtttgaacgagcctggtggttct 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 511 gtaaggttggataaccttatactggaagcaataactagtttgaacgagcctggtggttct 570
Query: 421 aacaagacaaatattgctgcttacatagaggaccaatactgggcgccgtcagacttcaaa 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 571 aacaagacaaatattgctgcttacatagaggaccaatactgggcgccgtcagacttcaaa 630
Query: 481 atgttgttgtccgcaaaattgaagtttttgacagctagtggaaaactgatcaaggtaaag 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 631 atgttgttgtccgcaaaattgaagtttttgacagctagtggaaaactgatcaaggtaaag 690
Query: 541 cgccggtataggattgcacctactactccagcatatccagagagaagaagaaactcatcc 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 691 cgccggtataggattgcacctactactccagcatatccagagagaagaagaaactcatcc 750
Query: 601 atgtcattattaactgggaggcagaaagcctctgtgaaccttgagaaggatgaggccaac 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 751 atgtcattattaactgggaggcagaaagcctctgtgaaccttgagaaggatgaggccaac 810
Query: 661 atccagacaaagtctcagatagatgtagaaatagcaaggttaaggtccatgactccacaa 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 811 atccagacaaagtctcagatagatgtagaaatagcaaggttaaggtccatgactccacaa 870
Query: 721 gaagcagctgcag 733
|||||||||||||
Sbjct: 871 gaagcagctgcag 883
Score = 139 bits (70), Expect = 3e-32
Identities = 77/78 (98%), Gaps = 1/78 (1%)
Strand = Plus / Plus
Query: 826 gctgcagaagcttttgcacaagctgcaatgaagaccatgaaagagagaaacaccccaaag 885
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 877 gctgcagaagcttttgcacaagctgcaatgaagaccatgaaagagagaaacaccccaaag 936
Query: 886 aagattataccttcttga 903
|||| |||||||||||||
Sbjct: 937 aaga-tataccttcttga 953
>gnl|LJGI|TC78026 similar to UniRef100_Q0PJL7 Cluster: MYB transcription factor
MYB55; n=1; Glycine max|Rep: MYB transcription factor
MYB55 - Glycine max (Soybean), partial (20%)
Length = 606
Score = 414 bits (209), Expect = e-115
Identities = 219/221 (99%), Gaps = 1/221 (0%)
Strand = Plus / Plus
Query: 684 tgtagaaatagcaaggttaaggtccatg-actccacaagaagcagctgcagttgctgctc 742
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 1 tgtagaaatagcaagtttaaggtccatggactccacaagaagcagctgcagttgctgctc 60
Query: 743 gagcagtcgaggaagcagaagccgccatagcagaagctgaagaggcagcccgagaggcag 802
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 gagcagtcgaggaagcagaagccgccatagcagaagctgaagaggcagcccgagaggcag 120
Query: 803 aggctgcagaagctgaggcggaggctgcagaagcttttgcacaagctgcaatgaagacca 862
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 aggctgcagaagctgaggcggaggctgcagaagcttttgcacaagctgcaatgaagacca 180
Query: 863 tgaaagagagaaacaccccaaagaagattataccttcttga 903
|||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tgaaagagagaaacaccccaaagaagattataccttcttga 221
>gnl|LJGI|TC62575 similar to UniRef100_Q0PJK3 Cluster: MYB transcription factor
MYB85; n=1; Glycine max|Rep: MYB transcription factor
MYB85 - Glycine max (Soybean), partial (35%)
Length = 757
Score = 61.9 bits (31), Expect = 6e-09
Identities = 79/95 (83%)
Strand = Plus / Plus
Query: 1 atgggtgctcccaagcaaaaatggactgctgaagaggaagcagcacttaaagctggggtg 60
||||||||||| ||||| ||||||||||| ||||| ||||| || || |||||||| ||
Sbjct: 445 atgggtgctcctaagcagaaatggactgcagaagaagaagcggcgctgaaagctggagta 504
Query: 61 gtcaagcatggagttggtaaatggcgtacgatact 95
||||| || || | ||| |||||||| || |||||
Sbjct: 505 gtcaaacacggggctggaaaatggcgcaccatact 539
>gnl|LJGI|TC74646 similar to UniRef100_Q0PJG6 Cluster: MYB transcription factor
MYB130; n=1; Glycine max|Rep: MYB transcription factor
MYB130 - Glycine max (Soybean), partial (35%)
Length = 579
Score = 56.0 bits (28), Expect = 4e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 787 gcagcccgagaggcagaggctgcagaagctgaggcggaggctgc 830
|||||| | ||||||||||||||||||||||| || ||||||||
Sbjct: 119 gcagccagggaggcagaggctgcagaagctgaagctgaggctgc 162