Miyakogusa Predicted Gene
- Lj6g3v1589790.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1589790.1 Non Chatacterized Hit- tr|I1L0K7|I1L0K7_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,60.17,0,no
description,DNA-binding WRKY; WRKY,DNA-binding WRKY; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,N,CUFF.59641.1
(1404 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC67366 similar to UniRef100_Q8T6M4 Cluster: Bicoid; n=... 573 e-162
gnl|LJGI|TC62763 homologue to UniRef100_Q84J64 Cluster: WRKY tra... 109 5e-23
gnl|LJGI|TC73036 homologue to UniRef100_A7LHI8 Cluster: WRKY52; ... 86 7e-16
gnl|LJGI|TC77072 similar to UniRef100_Q84J64 Cluster: WRKY trans... 80 4e-14
gnl|LJGI|TC76870 similar to UniRef100_A7PLF6 Cluster: Chromosome... 64 3e-09
gnl|LJGI|DC594962 homologue to UniRef100_A7LHI8 Cluster: WRKY52;... 60 4e-08
>gnl|LJGI|TC67366 similar to UniRef100_Q8T6M4 Cluster: Bicoid; n=1; Drosophila
persimilis|Rep: Bicoid - Drosophila persimilis (Fruit
fly), partial (6%)
Length = 798
Score = 573 bits (289), Expect = e-162
Identities = 289/289 (100%)
Strand = Plus / Plus
Query: 181 ttctcttctgatcctatgattttcaacaattttggtgatccattctcaaccttcagagat 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 ttctcttctgatcctatgattttcaacaattttggtgatccattctcaaccttcagagat 569
Query: 241 cctcttcttctgcaagaccttgatattccttcagtttcttcctacttcaatacttctaca 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 cctcttcttctgcaagaccttgatattccttcagtttcttcctacttcaatacttctaca 629
Query: 301 acagactctgggggtttggaacaagcagttgttgcagctagtggttttggtggtgttatt 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 630 acagactctgggggtttggaacaagcagttgttgcagctagtggttttggtggtgttatt 689
Query: 361 agtggtaatagtgctactaataatacaaatgtttctgcttcttctgtttttgctcacaag 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 690 agtggtaatagtgctactaataatacaaatgtttctgcttcttctgtttttgctcacaag 749
Query: 421 gtggttgaagataatcatgacatgatgaggaggccttgtaagaacatat 469
|||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 gtggttgaagataatcatgacatgatgaggaggccttgtaagaacatat 798
Score = 167 bits (84), Expect = 2e-40
Identities = 84/84 (100%)
Strand = Plus / Plus
Query: 1 atgtgcagcatctttgtctcaaccatggacaacaattaccaatttggagatttaactgac 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 atgtgcagcatctttgtctcaaccatggacaacaattaccaatttggagatttaactgac 389
Query: 61 atactcagggctagtggtggaact 84
||||||||||||||||||||||||
Sbjct: 390 atactcagggctagtggtggaact 413
>gnl|LJGI|TC62763 homologue to UniRef100_Q84J64 Cluster: WRKY transcription factor
22; n=1; Capsella rubella|Rep: WRKY transcription factor
22 - Capsella rubella, partial (38%)
Length = 1383
Score = 109 bits (55), Expect = 5e-23
Identities = 145/175 (82%)
Strand = Plus / Plus
Query: 710 cttcagatttgtgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatc 769
|||||||| | ||||| ||||| |||||||| ||||||||||||||||| ||||| ||||
Sbjct: 579 cttcagatgtttgggcatggaggaaatatggacagaaacccattaaagggtcaccatatc 638
Query: 770 ccaggggttattatagatgcagtagctcaaagggttgttctgcaaggaagcaagttgaga 829
| ||||| || || ||||| || |||||||| || |||| |||||||| ||||||||||
Sbjct: 639 caaggggatactacagatgtagcagctcaaaagggtgtttagcaaggaaacaagttgaga 698
Query: 830 ggagcaggacagacccaaacatgttggttattacttacacttcagagcacaacca 884
||| ||| ||||||||| ||||| || | || ||||| |||||||||||||
Sbjct: 699 ggaacagatcagacccaacaatgttcattgtcacctacacagcagagcacaacca 753
>gnl|LJGI|TC73036 homologue to UniRef100_A7LHI8 Cluster: WRKY52; n=1; Glycine
max|Rep: WRKY52 - Glycine max (Soybean), partial (48%)
Length = 665
Score = 85.7 bits (43), Expect = 7e-16
Identities = 91/107 (85%)
Strand = Plus / Plus
Query: 721 tgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatcccaggggttat 780
||||| |||||||| || |||||||| ||||| |||||||| |||||||||||||| ||
Sbjct: 411 tgggcctggagaaagtacggtcagaagcccatcaaaggttccccttatcccaggggatac 470
Query: 781 tatagatgcagtagctcaaagggttgttctgcaaggaagcaagttga 827
|| ||||||| || |||||||| || | |||||||||||||||||
Sbjct: 471 taccgatgcagcagttcaaagggatgccccgcaaggaagcaagttga 517
>gnl|LJGI|TC77072 similar to UniRef100_Q84J64 Cluster: WRKY transcription factor 22;
n=1; Capsella rubella|Rep: WRKY transcription factor 22
- Capsella rubella, partial (39%)
Length = 1463
Score = 79.8 bits (40), Expect = 4e-14
Identities = 94/112 (83%)
Strand = Plus / Plus
Query: 721 tgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatcccaggggttat 780
||||| ||||| ||||||||||||||||| || ||||| ||||| ||||| ||||| |||
Sbjct: 578 tgggcatggaggaaatatggtcagaaacctatcaaagggtcaccatatccaaggggatat 637
Query: 781 tatagatgcagtagctcaaagggttgttctgcaaggaagcaagttgagagga 832
|| ||||| || |||||||| || |||| || ||||| ||||| |||||||
Sbjct: 638 tacagatgtagcagctcaaaagggtgtttagctaggaaacaagtggagagga 689
>gnl|LJGI|TC76870 similar to UniRef100_A7PLF6 Cluster: Chromosome chr7 scaffold_20,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr7 scaffold_20, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (60%)
Length = 1415
Score = 63.9 bits (32), Expect = 3e-09
Identities = 50/56 (89%)
Strand = Plus / Plus
Query: 727 tggagaaaatatggtcagaaacccattaaaggttcaccttatcccaggggttatta 782
||||||||||||||||||||||| |||||||| || ||| |||| ||||| |||||
Sbjct: 893 tggagaaaatatggtcagaaacctattaaaggatcccctcatccaaggggatatta 948
>gnl|LJGI|DC594962 homologue to UniRef100_A7LHI8 Cluster: WRKY52; n=1; Glycine
max|Rep: WRKY52 - Glycine max (Soybean), partial (29%)
Length = 557
Score = 60.0 bits (30), Expect = 4e-08
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 721 tgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatcccagg 774
||||| |||||||| || |||||||| ||||| |||||||| ||||||||||||
Sbjct: 447 tgggcctggagaaagtacggtcagaagcccatcaaaggttccccttatcccagg 500