Miyakogusa Predicted Gene

Lj6g3v1589790.1
Show Alignment: 
BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1589790.1 Non Chatacterized Hit- tr|I1L0K7|I1L0K7_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,60.17,0,no
description,DNA-binding WRKY; WRKY,DNA-binding WRKY; SUBFAMILY NOT
NAMED,NULL; FAMILY NOT NAMED,N,CUFF.59641.1
         (1404 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC67366 similar to UniRef100_Q8T6M4 Cluster: Bicoid; n=...   573   e-162
gnl|LJGI|TC62763 homologue to UniRef100_Q84J64 Cluster: WRKY tra...   109   5e-23
gnl|LJGI|TC73036 homologue to UniRef100_A7LHI8 Cluster: WRKY52; ...    86   7e-16
gnl|LJGI|TC77072 similar to UniRef100_Q84J64 Cluster: WRKY trans...    80   4e-14
gnl|LJGI|TC76870 similar to UniRef100_A7PLF6 Cluster: Chromosome...    64   3e-09
gnl|LJGI|DC594962 homologue to UniRef100_A7LHI8 Cluster: WRKY52;...    60   4e-08

>gnl|LJGI|TC67366 similar to UniRef100_Q8T6M4 Cluster: Bicoid; n=1; Drosophila
           persimilis|Rep: Bicoid - Drosophila persimilis (Fruit
           fly), partial (6%)
          Length = 798

 Score =  573 bits (289), Expect = e-162
 Identities = 289/289 (100%)
 Strand = Plus / Plus

                                                                       
Query: 181 ttctcttctgatcctatgattttcaacaattttggtgatccattctcaaccttcagagat 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 ttctcttctgatcctatgattttcaacaattttggtgatccattctcaaccttcagagat 569

                                                                       
Query: 241 cctcttcttctgcaagaccttgatattccttcagtttcttcctacttcaatacttctaca 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 cctcttcttctgcaagaccttgatattccttcagtttcttcctacttcaatacttctaca 629

                                                                       
Query: 301 acagactctgggggtttggaacaagcagttgttgcagctagtggttttggtggtgttatt 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 630 acagactctgggggtttggaacaagcagttgttgcagctagtggttttggtggtgttatt 689

                                                                       
Query: 361 agtggtaatagtgctactaataatacaaatgtttctgcttcttctgtttttgctcacaag 420
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 690 agtggtaatagtgctactaataatacaaatgtttctgcttcttctgtttttgctcacaag 749

                                                            
Query: 421 gtggttgaagataatcatgacatgatgaggaggccttgtaagaacatat 469
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 750 gtggttgaagataatcatgacatgatgaggaggccttgtaagaacatat 798



 Score =  167 bits (84), Expect = 2e-40
 Identities = 84/84 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgtgcagcatctttgtctcaaccatggacaacaattaccaatttggagatttaactgac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 330 atgtgcagcatctttgtctcaaccatggacaacaattaccaatttggagatttaactgac 389

                                   
Query: 61  atactcagggctagtggtggaact 84
           ||||||||||||||||||||||||
Sbjct: 390 atactcagggctagtggtggaact 413


>gnl|LJGI|TC62763 homologue to UniRef100_Q84J64 Cluster: WRKY transcription factor
           22; n=1; Capsella rubella|Rep: WRKY transcription factor
           22 - Capsella rubella, partial (38%)
          Length = 1383

 Score =  109 bits (55), Expect = 5e-23
 Identities = 145/175 (82%)
 Strand = Plus / Plus

                                                                       
Query: 710 cttcagatttgtgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatc 769
           |||||||| | ||||| ||||| |||||||| ||||||||||||||||| ||||| ||||
Sbjct: 579 cttcagatgtttgggcatggaggaaatatggacagaaacccattaaagggtcaccatatc 638

                                                                       
Query: 770 ccaggggttattatagatgcagtagctcaaagggttgttctgcaaggaagcaagttgaga 829
           | ||||| || || ||||| || |||||||| || ||||  |||||||| ||||||||||
Sbjct: 639 caaggggatactacagatgtagcagctcaaaagggtgtttagcaaggaaacaagttgaga 698

                                                                  
Query: 830 ggagcaggacagacccaaacatgttggttattacttacacttcagagcacaacca 884
           ||| |||  |||||||||  |||||  || | || |||||  |||||||||||||
Sbjct: 699 ggaacagatcagacccaacaatgttcattgtcacctacacagcagagcacaacca 753


>gnl|LJGI|TC73036 homologue to UniRef100_A7LHI8 Cluster: WRKY52; n=1; Glycine
           max|Rep: WRKY52 - Glycine max (Soybean), partial (48%)
          Length = 665

 Score = 85.7 bits (43), Expect = 7e-16
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 721 tgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatcccaggggttat 780
           ||||| |||||||| || |||||||| ||||| |||||||| |||||||||||||| || 
Sbjct: 411 tgggcctggagaaagtacggtcagaagcccatcaaaggttccccttatcccaggggatac 470

                                                          
Query: 781 tatagatgcagtagctcaaagggttgttctgcaaggaagcaagttga 827
           ||  ||||||| || |||||||| ||  | |||||||||||||||||
Sbjct: 471 taccgatgcagcagttcaaagggatgccccgcaaggaagcaagttga 517


>gnl|LJGI|TC77072 similar to UniRef100_Q84J64 Cluster: WRKY transcription factor 22;
           n=1; Capsella rubella|Rep: WRKY transcription factor 22
           - Capsella rubella, partial (39%)
          Length = 1463

 Score = 79.8 bits (40), Expect = 4e-14
 Identities = 94/112 (83%)
 Strand = Plus / Plus

                                                                       
Query: 721 tgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatcccaggggttat 780
           ||||| ||||| ||||||||||||||||| || ||||| ||||| ||||| ||||| |||
Sbjct: 578 tgggcatggaggaaatatggtcagaaacctatcaaagggtcaccatatccaaggggatat 637

                                                               
Query: 781 tatagatgcagtagctcaaagggttgttctgcaaggaagcaagttgagagga 832
           || ||||| || |||||||| || ||||  || ||||| ||||| |||||||
Sbjct: 638 tacagatgtagcagctcaaaagggtgtttagctaggaaacaagtggagagga 689


>gnl|LJGI|TC76870 similar to UniRef100_A7PLF6 Cluster: Chromosome chr7 scaffold_20,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_20, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (60%)
          Length = 1415

 Score = 63.9 bits (32), Expect = 3e-09
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 727 tggagaaaatatggtcagaaacccattaaaggttcaccttatcccaggggttatta 782
           ||||||||||||||||||||||| |||||||| || ||| |||| ||||| |||||
Sbjct: 893 tggagaaaatatggtcagaaacctattaaaggatcccctcatccaaggggatatta 948


>gnl|LJGI|DC594962 homologue to UniRef100_A7LHI8 Cluster: WRKY52; n=1; Glycine
           max|Rep: WRKY52 - Glycine max (Soybean), partial (29%)
          Length = 557

 Score = 60.0 bits (30), Expect = 4e-08
 Identities = 48/54 (88%)
 Strand = Plus / Plus

                                                                 
Query: 721 tgggcttggagaaaatatggtcagaaacccattaaaggttcaccttatcccagg 774
           ||||| |||||||| || |||||||| ||||| |||||||| ||||||||||||
Sbjct: 447 tgggcctggagaaagtacggtcagaagcccatcaaaggttccccttatcccagg 500