Miyakogusa Predicted Gene
- Lj6g3v1464000.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1464000.1 tr|I1MGM6|I1MGM6_SOYBN 3-ketoacyl-CoA synthase
OS=Glycine max PE=3 SV=1,81.48,0,FAMILY NOT NAMED,NULL;
Thiolase-like,Thiolase-like; no description,Thiolase-like, subgroup;
FAE1_CUT,gene.g66262.t1.1
(1153 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP039611 similar to UniRef100_A7PYP0 Cluster: Chromosom... 84 2e-15
gnl|LJGI|TC68530 homologue to UniRef100_Q2QCW7 Cluster: 3-ketoac... 70 3e-11
gnl|LJGI|AV773511 homologue to UniRef100_A7P905 Cluster: Chromos... 56 5e-07
gnl|LJGI|TC59765 similar to UniRef100_A7P905 Cluster: Chromosome... 56 5e-07
gnl|LJGI|TC76841 similar to UniRef100_Q9XF43 Cluster: 3-ketoacyl... 52 8e-06
>gnl|LJGI|BP039611 similar to UniRef100_A7PYP0 Cluster: Chromosome chr12 scaffold_38,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr12 scaffold_38, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (22%)
Length = 509
Score = 83.8 bits (42), Expect = 2e-15
Identities = 48/50 (96%)
Strand = Plus / Minus
Query: 1018 tggcaaattgcctttggaagtggattcaagtgcaacagtgcagtgtggaa 1067
|||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 335 tggcaaattgcctttggaagtggattcaagtgtaacagtgcagtatggaa 286
>gnl|LJGI|TC68530 homologue to UniRef100_Q2QCW7 Cluster: 3-ketoacyl-CoA synthase; n=1;
Gossypium hirsutum|Rep: 3-ketoacyl-CoA synthase -
Gossypium hirsutum (Upland cotton) (Gossypium mexicanum),
partial (52%)
Length = 1190
Score = 69.9 bits (35), Expect = 3e-11
Identities = 89/107 (83%)
Strand = Plus / Plus
Query: 961 tggtatgagctgagctacatagaagcaaaagggaggatgaaacggggtgatacggtgtgg 1020
||||||||||||| |||||| ||| | || ||||||||||| | || |||| || |||
Sbjct: 571 tggtatgagctgaactacattgaatccaaggggaggatgaagagaggggatagagtttgg 630
Query: 1021 caaattgcctttggaagtggattcaagtgcaacagtgcagtgtggaa 1067
|| ||||| ||||| |||||||| || ||||||||||| ||||||||
Sbjct: 631 cagattgcgtttgggagtggatttaaatgcaacagtgctgtgtggaa 677
>gnl|LJGI|AV773511 homologue to UniRef100_A7P905 Cluster: Chromosome chr3 scaffold_8,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_8, whole genome shotgun sequence
- Vitis vinifera (Grape), partial (19%)
Length = 463
Score = 56.0 bits (28), Expect = 5e-07
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 1018 tggcaaattgcctttggaagtggattcaagtgcaacagtgcagtgtgg 1065
||||| ||||| ||||| |||||||||||||| |||||||| ||||||
Sbjct: 297 tggcagattgcatttgggagtggattcaagtgtaacagtgccgtgtgg 250
>gnl|LJGI|TC59765 similar to UniRef100_A7P905 Cluster: Chromosome chr3 scaffold_8,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_8, whole genome shotgun sequence
- Vitis vinifera (Grape), partial (38%)
Length = 806
Score = 56.0 bits (28), Expect = 5e-07
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 1018 tggcaaattgcctttggaagtggattcaagtgcaacagtgcagtgtgg 1065
||||| ||||| ||||||||||| |||||||| |||||||| ||||||
Sbjct: 472 tggcagattgcatttggaagtgggttcaagtgtaacagtgctgtgtgg 519
>gnl|LJGI|TC76841 similar to UniRef100_Q9XF43 Cluster: 3-ketoacyl-CoA synthase 6; n=2;
Arabidopsis thaliana|Rep: 3-ketoacyl-CoA synthase 6 -
Arabidopsis thaliana (Mouse-ear cress), partial (21%)
Length = 723
Score = 52.0 bits (26), Expect = 8e-06
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 940 aacacttcatctgcttcaatttggtatgagctgagctacatagaagcaaaagggaggatg 999
||||| || ||| ||||| | ||||||||||||| |||||| ||| |||||||||| |||
Sbjct: 91 aacacctcttcttcttcactatggtatgagctgaactacattgaatcaaaagggagaatg 150
Query: 1000 aa 1001
||
Sbjct: 151 aa 152