Miyakogusa Predicted Gene

Lj6g3v1464000.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1464000.1 tr|I1MGM6|I1MGM6_SOYBN 3-ketoacyl-CoA synthase
OS=Glycine max PE=3 SV=1,81.48,0,FAMILY NOT NAMED,NULL;
Thiolase-like,Thiolase-like; no description,Thiolase-like, subgroup;
FAE1_CUT,gene.g66262.t1.1
         (1153 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP039611 similar to UniRef100_A7PYP0 Cluster: Chromosom...    84   2e-15
gnl|LJGI|TC68530 homologue to UniRef100_Q2QCW7 Cluster: 3-ketoac...    70   3e-11
gnl|LJGI|AV773511 homologue to UniRef100_A7P905 Cluster: Chromos...    56   5e-07
gnl|LJGI|TC59765 similar to UniRef100_A7P905 Cluster: Chromosome...    56   5e-07
gnl|LJGI|TC76841 similar to UniRef100_Q9XF43 Cluster: 3-ketoacyl...    52   8e-06

>gnl|LJGI|BP039611 similar to UniRef100_A7PYP0 Cluster: Chromosome chr12 scaffold_38,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr12 scaffold_38, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (22%)
          Length = 509

 Score = 83.8 bits (42), Expect = 2e-15
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                              
Query: 1018 tggcaaattgcctttggaagtggattcaagtgcaacagtgcagtgtggaa 1067
            |||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 335  tggcaaattgcctttggaagtggattcaagtgtaacagtgcagtatggaa 286


>gnl|LJGI|TC68530 homologue to UniRef100_Q2QCW7 Cluster: 3-ketoacyl-CoA synthase; n=1;
            Gossypium hirsutum|Rep: 3-ketoacyl-CoA synthase -
            Gossypium hirsutum (Upland cotton) (Gossypium mexicanum),
            partial (52%)
          Length = 1190

 Score = 69.9 bits (35), Expect = 3e-11
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                        
Query: 961  tggtatgagctgagctacatagaagcaaaagggaggatgaaacggggtgatacggtgtgg 1020
            ||||||||||||| |||||| ||| | || |||||||||||  | || ||||  || |||
Sbjct: 571  tggtatgagctgaactacattgaatccaaggggaggatgaagagaggggatagagtttgg 630

                                                           
Query: 1021 caaattgcctttggaagtggattcaagtgcaacagtgcagtgtggaa 1067
            || ||||| ||||| |||||||| || ||||||||||| ||||||||
Sbjct: 631  cagattgcgtttgggagtggatttaaatgcaacagtgctgtgtggaa 677


>gnl|LJGI|AV773511 homologue to UniRef100_A7P905 Cluster: Chromosome chr3 scaffold_8,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr3 scaffold_8, whole genome shotgun sequence
            - Vitis vinifera (Grape), partial (19%)
          Length = 463

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                            
Query: 1018 tggcaaattgcctttggaagtggattcaagtgcaacagtgcagtgtgg 1065
            ||||| ||||| ||||| |||||||||||||| |||||||| ||||||
Sbjct: 297  tggcagattgcatttgggagtggattcaagtgtaacagtgccgtgtgg 250


>gnl|LJGI|TC59765 similar to UniRef100_A7P905 Cluster: Chromosome chr3 scaffold_8,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr3 scaffold_8, whole genome shotgun sequence
            - Vitis vinifera (Grape), partial (38%)
          Length = 806

 Score = 56.0 bits (28), Expect = 5e-07
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                            
Query: 1018 tggcaaattgcctttggaagtggattcaagtgcaacagtgcagtgtgg 1065
            ||||| ||||| ||||||||||| |||||||| |||||||| ||||||
Sbjct: 472  tggcagattgcatttggaagtgggttcaagtgtaacagtgctgtgtgg 519


>gnl|LJGI|TC76841 similar to UniRef100_Q9XF43 Cluster: 3-ketoacyl-CoA synthase 6; n=2;
            Arabidopsis thaliana|Rep: 3-ketoacyl-CoA synthase 6 -
            Arabidopsis thaliana (Mouse-ear cress), partial (21%)
          Length = 723

 Score = 52.0 bits (26), Expect = 8e-06
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                        
Query: 940  aacacttcatctgcttcaatttggtatgagctgagctacatagaagcaaaagggaggatg 999
            ||||| || ||| ||||| | ||||||||||||| |||||| ||| |||||||||| |||
Sbjct: 91   aacacctcttcttcttcactatggtatgagctgaactacattgaatcaaaagggagaatg 150

              
Query: 1000 aa 1001
            ||
Sbjct: 151  aa 152