Miyakogusa Predicted Gene
- Lj6g3v1444590.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1444590.1 tr|G7L2J4|G7L2J4_MEDTR 40S ribosomal protein S21
OS=Medicago truncatula GN=MTR_7g076530 PE=3 SV=1,92.59,7e-38,40S
RIBOSOMAL PROTEIN S21,Ribosomal protein S21e;
RS21B_ARATH_Q9M337;,Ribosomal protein S21e; Riboso,CUFF.59500.1
(249 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75455 homologue to UniRef100_Q2HVJ1 Cluster: Ribosoma... 494 e-139
gnl|LJGI|TC75752 homologue to UniRef100_Q2HVJ1 Cluster: Ribosoma... 311 1e-84
gnl|LJGI|BP078616 60 7e-09
>gnl|LJGI|TC75455 homologue to UniRef100_Q2HVJ1 Cluster: Ribosomal protein S21e; n=1;
Medicago truncatula|Rep: Ribosomal protein S21e -
Medicago truncatula (Barrel medic), partial (77%)
Length = 552
Score = 494 bits (249), Expect = e-139
Identities = 249/249 (100%)
Strand = Plus / Plus
Query: 1 atgcagaacgaagagggtcagatcaccgagctttacattcccaggaaatgctctgccaca 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 90 atgcagaacgaagagggtcagatcaccgagctttacattcccaggaaatgctctgccaca 149
Query: 61 aacagattgataactgcaaaggaccatgcttcggttcagatcaacattggtcatttggat 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 150 aacagattgataactgcaaaggaccatgcttcggttcagatcaacattggtcatttggat 209
Query: 121 gagagcggcgtctacaatggccagttctccacctacgccctttgcggttacatccgtgca 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 210 gagagcggcgtctacaatggccagttctccacctacgccctttgcggttacatccgtgca 269
Query: 181 cagggggatgctgacagtgcaatagatcgcctgtggcagaaaaagaaggctgagattaag 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 270 cagggggatgctgacagtgcaatagatcgcctgtggcagaaaaagaaggctgagattaag 329
Query: 241 caacactag 249
|||||||||
Sbjct: 330 caacactag 338
>gnl|LJGI|TC75752 homologue to UniRef100_Q2HVJ1 Cluster: Ribosomal protein S21e; n=1;
Medicago truncatula|Rep: Ribosomal protein S21e -
Medicago truncatula (Barrel medic), partial (76%)
Length = 496
Score = 311 bits (157), Expect = 1e-84
Identities = 223/245 (91%)
Strand = Plus / Plus
Query: 1 atgcagaacgaagagggtcagatcaccgagctttacattcccaggaaatgctctgccaca 60
|||||||||||||| || |||||||||||||| |||||||||||||| || || ||||||
Sbjct: 74 atgcagaacgaagaaggccagatcaccgagctctacattcccaggaagtgttcggccaca 133
Query: 61 aacagattgataactgcaaaggaccatgcttcggttcagatcaacattggtcatttggat 120
||||| ||||| |||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 134 aacaggttgatcactgcaaaggaccatgcttccgttcagatcaacattgggcatttggat 193
Query: 121 gagagcggcgtctacaatggccagttctccacctacgccctttgcggttacatccgtgca 180
||||| || ||||||||||| |||||||| ||||| || || || |||||||| |||||
Sbjct: 194 gagagtggtgtctacaatggacagttctctacctatgctctctgtggttacattcgtgct 253
Query: 181 cagggggatgctgacagtgcaatagatcgcctgtggcagaaaaagaaggctgagattaag 240
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||
Sbjct: 254 cagggggatgctgacagtgctatagatcgcctgtggcagaagaagaaggctgagattaag 313
Query: 241 caaca 245
|||||
Sbjct: 314 caaca 318
>gnl|LJGI|BP078616
Length = 466
Score = 60.0 bits (30), Expect = 7e-09
Identities = 51/58 (87%)
Strand = Plus / Minus
Query: 184 ggggatgctgacagtgcaatagatcgcctgtggcagaaaaagaaggctgagattaagc 241
|||||||||||||| || ||||| |||||||| ||| |||||||||||||||||||
Sbjct: 442 ggggatgctgacagagctttagattgcctgtggtagaggaagaaggctgagattaagc 385