Miyakogusa Predicted Gene

Lj6g3v1371780.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1371780.1 Non Chatacterized Hit- tr|I1MGY8|I1MGY8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51570
PE,78.18,0,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
PROTEIN_KINASE_ATP,Protein kinase, ATP binding site,gene.g66125.t1.1
         (1090 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP065880 weakly similar to UniRef100_A2Q1L9 Cluster: Pr...    60   3e-08
gnl|LJGI|TC58742 similar to UniRef100_A2Q1M1 Cluster: Protein ki...    60   3e-08

>gnl|LJGI|BP065880 weakly similar to UniRef100_A2Q1L9 Cluster: Protein kinase; n=1;
           Medicago truncatula|Rep: Protein kinase - Medicago
           truncatula (Barrel medic), partial (23%)
          Length = 509

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 856 aggcctataatgagtgttgtggtgaaaatgttggaaggttccgatgaaattcccaagcct 915
           |||||| ||||||||| |||||||| |||||||||||||   |  ||||||||||| |||
Sbjct: 302 aggcctttaatgagtggtgtggtgagaatgttggaaggtgtagtggaaattcccaaacct 243

                         
Query: 916 ttgaacccatttca 929
           ||||| || |||||
Sbjct: 242 ttgaatccttttca 229


>gnl|LJGI|TC58742 similar to UniRef100_A2Q1M1 Cluster: Protein kinase; n=1; Medicago
            truncatula|Rep: Protein kinase - Medicago truncatula
            (Barrel medic), partial (89%)
          Length = 1690

 Score = 60.0 bits (30), Expect = 3e-08
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                      
Query: 617  acaagtgtgatgtttacagttttggcattctgttatttgaaattataggtaggagaag 674
            |||||||||||||||| |||||||| |||||  | ||||||||| |||| ||||||||
Sbjct: 1077 acaagtgtgatgtttatagttttggtattcttctttttgaaattgtagggaggagaag 1134