Miyakogusa Predicted Gene
- Lj6g3v1370750.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1370750.1 Non Chatacterized Hit- tr|I1MGY8|I1MGY8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51570
PE,75.41,0,Serine/Threonine protein kinases,
catalytic,Serine/threonine- / dual-specificity protein kinase,
cat,CUFF.60004.1
(1036 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP065880 weakly similar to UniRef100_A2Q1L9 Cluster: Pr... 78 1e-13
>gnl|LJGI|BP065880 weakly similar to UniRef100_A2Q1L9 Cluster: Protein kinase; n=1;
Medicago truncatula|Rep: Protein kinase - Medicago
truncatula (Barrel medic), partial (23%)
Length = 509
Score = 77.8 bits (39), Expect = 1e-13
Identities = 218/278 (78%)
Strand = Plus / Minus
Query: 592 tttgaaattataggtaggagaagaaaccgtgatgctaaactttctgagagccaggagtgg 651
|||||||| |||| ||||||||| ||| |||| ||| ||| | || || || || |||
Sbjct: 506 tttgaaatcatagttaggagaaggaactttgatactagtcttccagaaagtcaagaatgg 447
Query: 652 tttccaatgtgggcttggaaaaaatttgatgctggagaacttggggagttaatgatagtg 711
||||||| |||| |||| ||||||||||| ||||| |||| | ||||| | ||||
Sbjct: 446 tttccaaggtggntttgggaaaaatttgattctggaaaactggaagagttgagaatagct 387
Query: 712 tgtgggatagaggagcaaaataaggatatagcagaaagaatggttaaggtagctctgtca 771
||| ||| |||||| |||||| ||| |||| ||| |||||| |||||||||| | |
Sbjct: 386 tgtcggaatgaggagaaaaatatggagatagtagagagaatgagtaaggtagctttatgg 327
Query: 772 tgtgttcagtataggccagaagtaaggcctatgatgagtgttgtggtgaaaatgttagaa 831
||||| ||||| ||| |||| | |||||| | ||||||| |||||||| |||||| |||
Sbjct: 326 tgtgtccagtacaggtcagagttgaggcctttaatgagtggtgtggtgagaatgttggaa 267
Query: 832 ggttcagatgaaattccaaagcctttgaatccatttca 869
||| || |||||||| || ||||||||||| |||||
Sbjct: 266 ggtgtagtggaaattcccaaacctttgaatccttttca 229