Miyakogusa Predicted Gene

Lj6g3v1369700.3
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1369700.3 Non Chatacterized Hit- tr|Q65XV4|Q65XV4_ORYSJ
Putative uncharacterized protein P0016H04.14 OS=Oryza
,26.28,0.28,seg,NULL,CUFF.59994.3
         (492 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC82317                                                       58   5e-08

>gnl|LJGI|TC82317 
          Length = 879

 Score = 58.0 bits (29), Expect = 5e-08
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggttgccaagaaaccggatactgaaattgcgcatatggtagagatgcttcaatttctt 60
           ||||||||||||||||| ||| |  ||||| | ||||||||||||||||||| || ||||
Sbjct: 106 atggttgccaagaaaccagatgcaaaaattacacatatggtagagatgcttcgatgtctt 165

            
Query: 61  g 61
           |
Sbjct: 166 g 166