Miyakogusa Predicted Gene

Lj6g3v1368640.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1368640.1 Non Chatacterized Hit- tr|I1MGY8|I1MGY8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51570
PE,80.32,0,PROTEIN_KINASE_DOM,Protein kinase, catalytic domain;
Pkinase_Tyr,Serine-threonine/tyrosine-protein k,gene.g66111.t1.1
         (1227 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|BP065880 weakly similar to UniRef100_A2Q1L9 Cluster: Pr...    78   1e-13

>gnl|LJGI|BP065880 weakly similar to UniRef100_A2Q1L9 Cluster: Protein kinase; n=1;
            Medicago truncatula|Rep: Protein kinase - Medicago
            truncatula (Barrel medic), partial (23%)
          Length = 509

 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 218/278 (78%)
 Strand = Plus / Minus

                                                                        
Query: 784  tttgaaattataggtaggagaagaaaccgtgatgctaaactttctgagagccaggagtgg 843
            |||||||| |||| ||||||||| |||  |||| |||  ||| | || || || || |||
Sbjct: 506  tttgaaatcatagttaggagaaggaactttgatactagtcttccagaaagtcaagaatgg 447

                                                                        
Query: 844  tttccaatgtgggcttggaaaaaatttgatgctggagaacttggggagttaatgatagtg 903
            ||||||| ||||  |||| ||||||||||| ||||| |||| |  ||||| |  ||||  
Sbjct: 446  tttccaaggtggntttgggaaaaatttgattctggaaaactggaagagttgagaatagct 387

                                                                        
Query: 904  tgtgggatagaggagcaaaataaggatatagcagaaagaatggttaaggtagctctgtca 963
            ||| |||  |||||| |||||| ||| |||| ||| ||||||  |||||||||| | |  
Sbjct: 386  tgtcggaatgaggagaaaaatatggagatagtagagagaatgagtaaggtagctttatgg 327

                                                                        
Query: 964  tgtgttcagtataggccagaagtaaggcctatgatgagtgttgtggtgaaaatgttagaa 1023
            ||||| ||||| ||| ||||  | |||||| | ||||||| |||||||| |||||| |||
Sbjct: 326  tgtgtccagtacaggtcagagttgaggcctttaatgagtggtgtggtgagaatgttggaa 267

                                                  
Query: 1024 ggttcagatgaaattccaaagcctttgaatccatttca 1061
            |||  ||  |||||||| || ||||||||||| |||||
Sbjct: 266  ggtgtagtggaaattcccaaacctttgaatccttttca 229