Miyakogusa Predicted Gene

Lj6g3v1318420.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1318420.1 gene.g66042.t1.1
         (1311 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81911 homologue to UniRef100_Q9SEH8 Cluster: Mannosyl...    80   4e-14

>gnl|LJGI|TC81911 homologue to UniRef100_Q9SEH8 Cluster: Mannosyl-oligosaccharide
            1,2-alpha-mannosidase; n=1; Glycine max|Rep:
            Mannosyl-oligosaccharide 1,2-alpha-mannosidase - Glycine
            max (Soybean), partial (41%)
          Length = 721

 Score = 79.8 bits (40), Expect = 4e-14
 Identities = 97/116 (83%)
 Strand = Plus / Plus

                                                                        
Query: 941  ttgagtcactgttttacctctggagattcactggaaacaagacttaccaagaatggggtt 1000
            |||||||||| || ||||| ||| |  | ||||| |||||||| ||||||||||||||||
Sbjct: 605  ttgagtcactcttctacctttggcgtctaactggcaacaagacataccaagaatggggtt 664

                                                                    
Query: 1001 ggaatattttccaagcatttgaaaagaactctcggactgagacaggatatgttgga 1056
            ||||||| || ||||| ||||| |||||||| || |  ||| |||| |||||||||
Sbjct: 665  ggaatatatttcaagcttttgagaagaactcccgcatagagtcaggctatgttgga 720