Miyakogusa Predicted Gene

Lj6g3v1094880.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1094880.1 Non Chatacterized Hit- tr|I1MHT2|I1MHT2_SOYBN
Uncharacterized protein OS=Glycine max PE=4 SV=1,89.5,0,seg,NULL;
SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
coiled-coil,NULL,CUFF.59100.1
         (546 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|AV768816 similar to UniRef100_A2Q365 Cluster: BTB/POZ; ...   446   e-125
gnl|LJGI|AW719754 similar to UniRef100_Q9FJY3 Cluster: Photorece...    52   4e-06

>gnl|LJGI|AV768816 similar to UniRef100_A2Q365 Cluster: BTB/POZ; Superoxide dismutase,
           copper/zinc binding; NPH3; n=1; Medicago truncatula|Rep:
           BTB/POZ; Superoxide dismutase, copper/zinc binding; NPH3
           - Medicago truncatula (Barrel medic), partial (11%)
          Length = 464

 Score =  446 bits (225), Expect = e-125
 Identities = 225/225 (100%)
 Strand = Plus / Minus

                                                                       
Query: 322 ctgggtcgttcaacaaagggatcatcatcgagcacttggggagctgtgtccaagaagctc 381
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 464 ctgggtcgttcaacaaagggatcatcatcgagcacttggggagctgtgtccaagaagctc 405

                                                                       
Query: 382 gggtttaagatgaagtctcagatgtgcagtgctcaagaaggatccgttagcaaccagaac 441
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 404 gggtttaagatgaagtctcagatgtgcagtgctcaagaaggatccgttagcaaccagaac 345

                                                                       
Query: 442 aatggaagtaataaggttgtgaagttgaaggagagacaagttaagcaccagagaagttct 501
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 aatggaagtaataaggttgtgaagttgaaggagagacaagttaagcaccagagaagttct 285

                                                        
Query: 502 tccattagtgataaagcttcactctcttcaattgttctttcttag 546
           |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 tccattagtgataaagcttcactctcttcaattgttctttcttag 240


>gnl|LJGI|AW719754 similar to UniRef100_Q9FJY3 Cluster: Photoreceptor-interacting
           protein-like; n=1; Arabidopsis thaliana|Rep:
           Photoreceptor-interacting protein-like - Arabidopsis
           thaliana (Mouse-ear cress), partial (24%)
          Length = 464

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 10  cagaagctctcactagaagcatgcacgcatgctgcgcagaacgagaggct 59
           ||||||||| | ||||| || |||||||| || |||||||||||||||||
Sbjct: 353 cagaagctcacgctagaggcgtgcacgcacgcggcgcagaacgagaggct 402