Miyakogusa Predicted Gene
- Lj6g3v1078310.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1078310.1 Non Chatacterized Hit- tr|I1JGN9|I1JGN9_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,86.21,0,FA_desaturase,Fatty acid desaturase, type 1,CUFF.58971.1
(468 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP042120 homologue to UniRef100_Q0J5E5 Cluster: Os08g04... 100 1e-20
>gnl|LJGI|BP042120 homologue to UniRef100_Q0J5E5 Cluster: Os08g0440900 protein; n=2;
Oryza sativa Japonica Group|Rep: Os08g0440900 protein -
Oryza sativa subsp. japonica (Rice), partial (18%)
Length = 473
Score = 99.6 bits (50), Expect = 1e-20
Identities = 89/102 (87%)
Strand = Plus / Minus
Query: 91 gtacatcatacagcaccacacataccattcaaatcctctggtgagtggaatgctgcacaa 150
||||||||||| ||||||||||||||||||||| ||| | ||||||||||||| |||
Sbjct: 473 gtacatcatactgcaccacacataccattcaaagactcagaaaagtggaatgctgctcaa 414
Query: 151 gcacagcttaatgggactattcattgtgattatcctaaatgg 192
|||||||| ||||| ||| ||||||||||||| ||| |||||
Sbjct: 413 gcacagctaaatggaactgttcattgtgattaccctcaatgg 372