Miyakogusa Predicted Gene
- Lj6g3v1065990.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1065990.1 CUFF.58899.1
(360 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS341299 similar to UniRef100_A7PY22 Cluster: Chromosom... 307 2e-83
gnl|LJGI|TC60575 similar to UniRef100_A7PY22 Cluster: Chromosome... 188 2e-47
gnl|LJGI|AV428771 similar to UniRef100_UPI000034F040 Cluster: be... 186 6e-47
gnl|LJGI|TC71539 similar to UniRef100_A7PY22 Cluster: Chromosome... 178 2e-44
gnl|LJGI|DC597049 similar to UniRef100_A7PY22 Cluster: Chromosom... 133 8e-31
gnl|LJGI|DC593134 82 3e-15
gnl|LJGI|TC60593 weakly similar to UniRef100_A4PY47 Cluster: TNP... 74 6e-13
gnl|LJGI|FS335701 weakly similar to UniRef100_Q04219 Cluster: TN... 66 2e-10
gnl|LJGI|TC67496 66 2e-10
gnl|LJGI|TC59706 66 2e-10
gnl|LJGI|DC593512 64 6e-10
gnl|LJGI|GO036563 homologue to UniRef100_A5BM41 Cluster: Ubiquit... 60 1e-08
>gnl|LJGI|FS341299 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr15 scaffold_37, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (3%)
Length = 760
Score = 307 bits (155), Expect = 2e-83
Identities = 161/163 (98%)
Strand = Plus / Plus
Query: 198 acctcatatcgcgtttccagatcgcgttttttcactctcctctacctcacttcacgttga 257
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2 acctcatatcgcgtttccagatcgcgttttttcactctcctctacctcacttcacgttga 61
Query: 258 acctctctcagcttctctctcagatcgcgattccttgactccttctcagcgatggcgaac 317
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62 acctctctcagcctctctctcagatcgcgattccttgactccttctcagcgatggcgaac 121
Query: 318 tccatggcttgaagggctcgaatttatcttgttttggtaaaat 360
||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 122 tccatggcttgaagggctcgaatttctcttgttttggtaaaat 164
>gnl|LJGI|TC60575 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr15 scaffold_37, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (7%)
Length = 1254
Score = 188 bits (95), Expect = 2e-47
Identities = 114/121 (94%), Gaps = 7/121 (5%)
Strand = Plus / Plus
Query: 247 cttcacgttgaacctctctcagcttctctctcagatcgcgattccttgactccttctcag 306
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2 cttcacgttgaacctctctcagcttctctctcagatcgcgattccttgactccttctcag 61
Query: 307 cgatggcgaactccatggcttga-------agggctcgaatttatcttgttttggtaaaa 359
||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 62 cgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttggtaaaa 121
Query: 360 t 360
|
Sbjct: 122 t 122
>gnl|LJGI|AV428771 similar to UniRef100_UPI000034F040 Cluster: beige/BEACH
domain-containing protein; n=1; Arabidopsis
thaliana|Rep: beige/BEACH domain-containing protein -
Arabidopsis thaliana, partial (3%)
Length = 421
Score = 186 bits (94), Expect = 6e-47
Identities = 100/102 (98%)
Strand = Plus / Plus
Query: 231 actctcctctacctcacttcacgttgaacctctctcagcttctctctcagatcgcgattc 290
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 actctcctctacctcacttcacgttgaacctctctcagcttctctctcagatcgcgattg 60
Query: 291 cttgactccttctcagcgatggcgaactccatggcttgaagg 332
||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 61 cttgactccgtctcagcgatggcgaactccatggcttgaagg 102
>gnl|LJGI|TC71539 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr15 scaffold_37, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (5%)
Length = 705
Score = 178 bits (90), Expect = 2e-44
Identities = 93/94 (98%)
Strand = Plus / Plus
Query: 237 ctctacctcacttcacgttgaacctctctcagcttctctctcagatcgcgattccttgac 296
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1 ctctacctcacttcacgttgaacctctctcagcctctctctcagatcgcgattccttgac 60
Query: 297 tccttctcagcgatggcgaactccatggcttgaa 330
||||||||||||||||||||||||||||||||||
Sbjct: 61 tccttctcagcgatggcgaactccatggcttgaa 94
Score = 81.8 bits (41), Expect = 3e-15
Identities = 60/67 (89%), Gaps = 7/67 (10%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 99 tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 158
Query: 354 gtaaaat 360
|||||||
Sbjct: 159 gtaaaat 165
>gnl|LJGI|DC597049 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:,
partial (0%)
Length = 312
Score = 133 bits (67), Expect = 8e-31
Identities = 70/71 (98%)
Strand = Plus / Plus
Query: 260 ctctctcagcttctctctcagatcgcgattccttgactccttctcagcgatggcgaactc 319
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 ctctctcagcctctctctcagatcgcgattccttgactccttctcagcgatggcgaactc 60
Query: 320 catggcttgaa 330
|||||||||||
Sbjct: 61 catggcttgaa 71
Score = 81.8 bits (41), Expect = 3e-15
Identities = 60/67 (89%), Gaps = 7/67 (10%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 76 tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 135
Query: 354 gtaaaat 360
|||||||
Sbjct: 136 gtaaaat 142
>gnl|LJGI|DC593134
Length = 592
Score = 81.8 bits (41), Expect = 3e-15
Identities = 60/67 (89%), Gaps = 7/67 (10%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 108 tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 167
Query: 354 gtaaaat 360
|||||||
Sbjct: 168 gtaaaat 174
Score = 65.9 bits (33), Expect = 2e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
||||||| |||||||||||||||||||||||||||||
Sbjct: 23 tctcagcctctctctcagatcgcgattccttgactcc 59
Score = 60.0 bits (30), Expect = 1e-08
Identities = 30/30 (100%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttgaa 330
||||||||||||||||||||||||||||||
Sbjct: 74 tctcagcgatggcgaactccatggcttgaa 103
>gnl|LJGI|TC60593 weakly similar to UniRef100_A4PY47 Cluster: TNP1, related; n=1;
Medicago truncatula|Rep: TNP1, related - Medicago
truncatula (Barrel medic), partial (6%)
Length = 960
Score = 73.8 bits (37), Expect = 6e-13
Identities = 56/63 (88%), Gaps = 7/63 (11%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 101 tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 160
Query: 354 gta 356
|||
Sbjct: 161 gta 163
Score = 65.9 bits (33), Expect = 2e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
||||||| |||||||||||||||||||||||||||||
Sbjct: 16 tctcagcctctctctcagatcgcgattccttgactcc 52
Score = 52.0 bits (26), Expect = 2e-06
Identities = 29/30 (96%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttgaa 330
||||||||||| ||||||||||||||||||
Sbjct: 67 tctcagcgatgtcgaactccatggcttgaa 96
>gnl|LJGI|FS335701 weakly similar to UniRef100_Q04219 Cluster: TNP2; n=1; Antirrhinum
majus|Rep: TNP2 - Antirrhinum majus (Garden snapdragon),
partial (11%)
Length = 711
Score = 65.9 bits (33), Expect = 2e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
||||||| |||||||||||||||||||||||||||||
Sbjct: 36 tctcagcctctctctcagatcgcgattccttgactcc 72
Score = 65.9 bits (33), Expect = 2e-10
Identities = 33/33 (100%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttgaaggg 333
|||||||||||||||||||||||||||||||||
Sbjct: 87 tctcagcgatggcgaactccatggcttgaaggg 119
>gnl|LJGI|TC67496
Length = 845
Score = 65.9 bits (33), Expect = 2e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
||||||| |||||||||||||||||||||||||||||
Sbjct: 15 tctcagcctctctctcagatcgcgattccttgactcc 51
Score = 63.9 bits (32), Expect = 6e-10
Identities = 32/32 (100%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttgaagg 332
||||||||||||||||||||||||||||||||
Sbjct: 66 tctcagcgatggcgaactccatggcttgaagg 97
>gnl|LJGI|TC59706
Length = 1191
Score = 65.9 bits (33), Expect = 2e-10
Identities = 36/37 (97%)
Strand = Plus / Plus
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
||||||| |||||||||||||||||||||||||||||
Sbjct: 41 tctcagcctctctctcagatcgcgattccttgactcc 77
Score = 65.9 bits (33), Expect = 2e-10
Identities = 33/33 (100%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttgaaggg 333
|||||||||||||||||||||||||||||||||
Sbjct: 92 tctcagcgatggcgaactccatggcttgaaggg 124
>gnl|LJGI|DC593512
Length = 515
Score = 63.9 bits (32), Expect = 6e-10
Identities = 32/32 (100%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttgaagg 332
||||||||||||||||||||||||||||||||
Sbjct: 43 tctcagcgatggcgaactccatggcttgaagg 74
Score = 56.0 bits (28), Expect = 2e-07
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 272 ctctctcagatcgcgattccttgactcc 299
||||||||||||||||||||||||||||
Sbjct: 1 ctctctcagatcgcgattccttgactcc 28
>gnl|LJGI|GO036563 homologue to UniRef100_A5BM41 Cluster: Ubiquitin carrier protein;
n=1; Vitis vinifera|Rep: Ubiquitin carrier protein -
Vitis vinifera (Grape), partial (26%)
Length = 580
Score = 60.0 bits (30), Expect = 1e-08
Identities = 30/30 (100%)
Strand = Plus / Plus
Query: 301 tctcagcgatggcgaactccatggcttgaa 330
||||||||||||||||||||||||||||||
Sbjct: 170 tctcagcgatggcgaactccatggcttgaa 199