Miyakogusa Predicted Gene

Lj6g3v1065990.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1065990.1 CUFF.58899.1
         (360 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS341299 similar to UniRef100_A7PY22 Cluster: Chromosom...   307   2e-83
gnl|LJGI|TC60575 similar to UniRef100_A7PY22 Cluster: Chromosome...   188   2e-47
gnl|LJGI|AV428771 similar to UniRef100_UPI000034F040 Cluster: be...   186   6e-47
gnl|LJGI|TC71539 similar to UniRef100_A7PY22 Cluster: Chromosome...   178   2e-44
gnl|LJGI|DC597049 similar to UniRef100_A7PY22 Cluster: Chromosom...   133   8e-31
gnl|LJGI|DC593134                                                      82   3e-15
gnl|LJGI|TC60593 weakly similar to UniRef100_A4PY47 Cluster: TNP...    74   6e-13
gnl|LJGI|FS335701 weakly similar to UniRef100_Q04219 Cluster: TN...    66   2e-10
gnl|LJGI|TC67496                                                       66   2e-10
gnl|LJGI|TC59706                                                       66   2e-10
gnl|LJGI|DC593512                                                      64   6e-10
gnl|LJGI|GO036563 homologue to UniRef100_A5BM41 Cluster: Ubiquit...    60   1e-08

>gnl|LJGI|FS341299 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr15 scaffold_37, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (3%)
          Length = 760

 Score =  307 bits (155), Expect = 2e-83
 Identities = 161/163 (98%)
 Strand = Plus / Plus

                                                                       
Query: 198 acctcatatcgcgtttccagatcgcgttttttcactctcctctacctcacttcacgttga 257
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   acctcatatcgcgtttccagatcgcgttttttcactctcctctacctcacttcacgttga 61

                                                                       
Query: 258 acctctctcagcttctctctcagatcgcgattccttgactccttctcagcgatggcgaac 317
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 62  acctctctcagcctctctctcagatcgcgattccttgactccttctcagcgatggcgaac 121

                                                      
Query: 318 tccatggcttgaagggctcgaatttatcttgttttggtaaaat 360
           ||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 122 tccatggcttgaagggctcgaatttctcttgttttggtaaaat 164


>gnl|LJGI|TC60575 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr15 scaffold_37, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (7%)
          Length = 1254

 Score =  188 bits (95), Expect = 2e-47
 Identities = 114/121 (94%), Gaps = 7/121 (5%)
 Strand = Plus / Plus

                                                                       
Query: 247 cttcacgttgaacctctctcagcttctctctcagatcgcgattccttgactccttctcag 306
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2   cttcacgttgaacctctctcagcttctctctcagatcgcgattccttgactccttctcag 61

                                                                       
Query: 307 cgatggcgaactccatggcttga-------agggctcgaatttatcttgttttggtaaaa 359
           |||||||||||||||||||||||       ||||||||||||||||||||||||||||||
Sbjct: 62  cgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttggtaaaa 121

            
Query: 360 t 360
           |
Sbjct: 122 t 122


>gnl|LJGI|AV428771 similar to UniRef100_UPI000034F040 Cluster: beige/BEACH
           domain-containing protein; n=1; Arabidopsis
           thaliana|Rep: beige/BEACH domain-containing protein -
           Arabidopsis thaliana, partial (3%)
          Length = 421

 Score =  186 bits (94), Expect = 6e-47
 Identities = 100/102 (98%)
 Strand = Plus / Plus

                                                                       
Query: 231 actctcctctacctcacttcacgttgaacctctctcagcttctctctcagatcgcgattc 290
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1   actctcctctacctcacttcacgttgaacctctctcagcttctctctcagatcgcgattg 60

                                                     
Query: 291 cttgactccttctcagcgatggcgaactccatggcttgaagg 332
           ||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 61  cttgactccgtctcagcgatggcgaactccatggcttgaagg 102


>gnl|LJGI|TC71539 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr15 scaffold_37, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (5%)
          Length = 705

 Score =  178 bits (90), Expect = 2e-44
 Identities = 93/94 (98%)
 Strand = Plus / Plus

                                                                       
Query: 237 ctctacctcacttcacgttgaacctctctcagcttctctctcagatcgcgattccttgac 296
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 1   ctctacctcacttcacgttgaacctctctcagcctctctctcagatcgcgattccttgac 60

                                             
Query: 297 tccttctcagcgatggcgaactccatggcttgaa 330
           ||||||||||||||||||||||||||||||||||
Sbjct: 61  tccttctcagcgatggcgaactccatggcttgaa 94



 Score = 81.8 bits (41), Expect = 3e-15
 Identities = 60/67 (89%), Gaps = 7/67 (10%)
 Strand = Plus / Plus

                                                                       
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
           |||||||||||||||||||||||||||||       ||||||||||||||||||||||||
Sbjct: 99  tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 158

                  
Query: 354 gtaaaat 360
           |||||||
Sbjct: 159 gtaaaat 165


>gnl|LJGI|DC597049 similar to UniRef100_A7PY22 Cluster: Chromosome chr15 scaffold_37
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:,
           partial (0%)
          Length = 312

 Score =  133 bits (67), Expect = 8e-31
 Identities = 70/71 (98%)
 Strand = Plus / Plus

                                                                       
Query: 260 ctctctcagcttctctctcagatcgcgattccttgactccttctcagcgatggcgaactc 319
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ctctctcagcctctctctcagatcgcgattccttgactccttctcagcgatggcgaactc 60

                      
Query: 320 catggcttgaa 330
           |||||||||||
Sbjct: 61  catggcttgaa 71



 Score = 81.8 bits (41), Expect = 3e-15
 Identities = 60/67 (89%), Gaps = 7/67 (10%)
 Strand = Plus / Plus

                                                                       
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
           |||||||||||||||||||||||||||||       ||||||||||||||||||||||||
Sbjct: 76  tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 135

                  
Query: 354 gtaaaat 360
           |||||||
Sbjct: 136 gtaaaat 142


>gnl|LJGI|DC593134 
          Length = 592

 Score = 81.8 bits (41), Expect = 3e-15
 Identities = 60/67 (89%), Gaps = 7/67 (10%)
 Strand = Plus / Plus

                                                                       
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
           |||||||||||||||||||||||||||||       ||||||||||||||||||||||||
Sbjct: 108 tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 167

                  
Query: 354 gtaaaat 360
           |||||||
Sbjct: 168 gtaaaat 174



 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
           ||||||| |||||||||||||||||||||||||||||
Sbjct: 23  tctcagcctctctctcagatcgcgattccttgactcc 59



 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 301 tctcagcgatggcgaactccatggcttgaa 330
           ||||||||||||||||||||||||||||||
Sbjct: 74  tctcagcgatggcgaactccatggcttgaa 103


>gnl|LJGI|TC60593 weakly similar to UniRef100_A4PY47 Cluster: TNP1, related; n=1;
           Medicago truncatula|Rep: TNP1, related - Medicago
           truncatula (Barrel medic), partial (6%)
          Length = 960

 Score = 73.8 bits (37), Expect = 6e-13
 Identities = 56/63 (88%), Gaps = 7/63 (11%)
 Strand = Plus / Plus

                                                                       
Query: 301 tctcagcgatggcgaactccatggcttga-------agggctcgaatttatcttgttttg 353
           |||||||||||||||||||||||||||||       ||||||||||||||||||||||||
Sbjct: 101 tctcagcgatggcgaactccatggcttgaaggaattagggctcgaatttatcttgttttg 160

              
Query: 354 gta 356
           |||
Sbjct: 161 gta 163



 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
           ||||||| |||||||||||||||||||||||||||||
Sbjct: 16  tctcagcctctctctcagatcgcgattccttgactcc 52



 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 301 tctcagcgatggcgaactccatggcttgaa 330
           ||||||||||| ||||||||||||||||||
Sbjct: 67  tctcagcgatgtcgaactccatggcttgaa 96


>gnl|LJGI|FS335701 weakly similar to UniRef100_Q04219 Cluster: TNP2; n=1; Antirrhinum
           majus|Rep: TNP2 - Antirrhinum majus (Garden snapdragon),
           partial (11%)
          Length = 711

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
           ||||||| |||||||||||||||||||||||||||||
Sbjct: 36  tctcagcctctctctcagatcgcgattccttgactcc 72



 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 33/33 (100%)
 Strand = Plus / Plus

                                            
Query: 301 tctcagcgatggcgaactccatggcttgaaggg 333
           |||||||||||||||||||||||||||||||||
Sbjct: 87  tctcagcgatggcgaactccatggcttgaaggg 119


>gnl|LJGI|TC67496 
          Length = 845

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
           ||||||| |||||||||||||||||||||||||||||
Sbjct: 15  tctcagcctctctctcagatcgcgattccttgactcc 51



 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                           
Query: 301 tctcagcgatggcgaactccatggcttgaagg 332
           ||||||||||||||||||||||||||||||||
Sbjct: 66  tctcagcgatggcgaactccatggcttgaagg 97


>gnl|LJGI|TC59706 
          Length = 1191

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 36/37 (97%)
 Strand = Plus / Plus

                                                
Query: 263 tctcagcttctctctcagatcgcgattccttgactcc 299
           ||||||| |||||||||||||||||||||||||||||
Sbjct: 41  tctcagcctctctctcagatcgcgattccttgactcc 77



 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 33/33 (100%)
 Strand = Plus / Plus

                                            
Query: 301 tctcagcgatggcgaactccatggcttgaaggg 333
           |||||||||||||||||||||||||||||||||
Sbjct: 92  tctcagcgatggcgaactccatggcttgaaggg 124


>gnl|LJGI|DC593512 
          Length = 515

 Score = 63.9 bits (32), Expect = 6e-10
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                           
Query: 301 tctcagcgatggcgaactccatggcttgaagg 332
           ||||||||||||||||||||||||||||||||
Sbjct: 43  tctcagcgatggcgaactccatggcttgaagg 74



 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 28/28 (100%)
 Strand = Plus / Plus

                                       
Query: 272 ctctctcagatcgcgattccttgactcc 299
           ||||||||||||||||||||||||||||
Sbjct: 1   ctctctcagatcgcgattccttgactcc 28


>gnl|LJGI|GO036563 homologue to UniRef100_A5BM41 Cluster: Ubiquitin carrier protein;
           n=1; Vitis vinifera|Rep: Ubiquitin carrier protein -
           Vitis vinifera (Grape), partial (26%)
          Length = 580

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 30/30 (100%)
 Strand = Plus / Plus

                                         
Query: 301 tctcagcgatggcgaactccatggcttgaa 330
           ||||||||||||||||||||||||||||||
Sbjct: 170 tctcagcgatggcgaactccatggcttgaa 199