Miyakogusa Predicted Gene
- Lj6g3v1065800.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1065800.1 tr|K2R0N7|K2R0N7_9BURK DUF404 domain containing
protein (Fragment) OS=Herbaspirillum frisingense
GSF,30.56,5.1,seg,NULL,CUFF.58877.1
(345 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP050906 78 4e-14
gnl|LJGI|TC77843 72 2e-12
gnl|LJGI|FS337869 similar to UniRef100_Q9LTI7 Cluster: Oxysterol... 62 2e-09
gnl|LJGI|TC77926 UniRef100_A6RH13 Cluster: Predicted protein; n=... 56 1e-07
gnl|LJGI|TC69043 56 1e-07
gnl|LJGI|FS350483 54 6e-07
gnl|LJGI|TC63428 weakly similar to UniRef100_A7F9X7 Cluster: Pre... 50 9e-06
>gnl|LJGI|BP050906
Length = 483
Score = 77.8 bits (39), Expect = 4e-14
Identities = 45/47 (95%)
Strand = Plus / Plus
Query: 74 atcttcatctcttccttcatgatcttcatcttcctcatggtatacaa 120
||||||||||||||| ||||||||||||||||| |||||||||||||
Sbjct: 317 atcttcatctcttccctcatgatcttcatcttcttcatggtatacaa 363
>gnl|LJGI|TC77843
Length = 457
Score = 71.9 bits (36), Expect = 2e-12
Identities = 48/52 (92%)
Strand = Plus / Plus
Query: 3 gaataaaattcattcaaggacgaatgtgaagtcggtggacacattcagggac 54
|||||||||||||||| ||||||||||||||||||| ||||| |||| ||||
Sbjct: 264 gaataaaattcattcagggacgaatgtgaagtcggttgacactttcaaggac 315
>gnl|LJGI|FS337869 similar to UniRef100_Q9LTI7 Cluster: Oxysterol-binding protein;
n=1; Arabidopsis thaliana|Rep: Oxysterol-binding
protein - Arabidopsis thaliana (Mouse-ear cress),
partial (43%)
Length = 766
Score = 61.9 bits (31), Expect = 2e-09
Identities = 34/35 (97%)
Strand = Plus / Plus
Query: 38 tggacacattcagggacgaacttggctatttaccc 72
||||||| |||||||||||||||||||||||||||
Sbjct: 1 tggacactttcagggacgaacttggctatttaccc 35
>gnl|LJGI|TC77926 UniRef100_A6RH13 Cluster: Predicted protein; n=1; Ajellomyces
capsulatus NAm1|Rep: Predicted protein - Ajellomyces
capsulata (strain NAm1) (Histoplasma capsulatum),
partial (6%)
Length = 637
Score = 56.0 bits (28), Expect = 1e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 29 tgaagtcggtggacacattcagggacgaacttggctatttaccc 72
||||| |||| ||||||||||||||| || ||||||||||||||
Sbjct: 490 tgaaggcggttgacacattcagggaccaagttggctatttaccc 533
>gnl|LJGI|TC69043
Length = 531
Score = 56.0 bits (28), Expect = 1e-07
Identities = 40/44 (90%)
Strand = Plus / Plus
Query: 29 tgaagtcggtggacacattcagggacgaacttggctatttaccc 72
||||| |||| ||||||||||||||| || ||||||||||||||
Sbjct: 335 tgaaggcggttgacacattcagggaccaagttggctatttaccc 378
>gnl|LJGI|FS350483
Length = 650
Score = 54.0 bits (27), Expect = 6e-07
Identities = 45/51 (88%)
Strand = Plus / Plus
Query: 4 aataaaattcattcaaggacgaatgtgaagtcggtggacacattcagggac 54
|||||||||| | || |||||| | ||||||||||||||||||| ||||||
Sbjct: 106 aataaaattcttccagggacgactttgaagtcggtggacacatttagggac 156
>gnl|LJGI|TC63428 weakly similar to UniRef100_A7F9X7 Cluster: Predicted protein; n=1;
Sclerotinia sclerotiorum 1980|Rep: Predicted protein -
Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 /
Ss-1) (Whitemold) (Whetzelinia sclerotiorum), partial
(6%)
Length = 743
Score = 50.1 bits (25), Expect = 9e-06
Identities = 44/49 (89%), Gaps = 1/49 (2%)
Strand = Plus / Plus
Query: 237 ccacaaccacccttccatctttgattttctcctccttcttcatcctcaa 285
|||||||||| ||| ||||| |||||||||||| ||||||||||||||
Sbjct: 41 ccacaaccactctttcatctc-gattttctcctctttcttcatcctcaa 88