Miyakogusa Predicted Gene

Lj6g3v1038780.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v1038780.1 tr|I1JFT4|I1JFT4_SOYBN Lipoxygenase OS=Glycine
max GN=Gma.53954 PE=3 SV=1,80.25,0,LIPOXYGENASE,Lipoxygenase,
C-terminal; Lipoxygenase,Lipoxygenase, C-terminal;
LIPOXYGENASE_2,Lipoxyg,CUFF.58797.1
         (1002 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68653 similar to UniRef100_A2TEX8 Cluster: Lipoxygena...   105   5e-22
gnl|LJGI|TC79534 similar to UniRef100_A2TEX8 Cluster: Lipoxygena...   100   3e-20

>gnl|LJGI|TC68653 similar to UniRef100_A2TEX8 Cluster: Lipoxygenase; n=1; Phaseolus
           vulgaris|Rep: Lipoxygenase - Phaseolus vulgaris (Kidney
           bean) (French bean), partial (37%)
          Length = 1204

 Score =  105 bits (53), Expect = 5e-22
 Identities = 98/113 (86%)
 Strand = Plus / Plus

                                                                       
Query: 613 aatgctcctcatggcctaaagctaacaattgaagactacccttttgccaatgatggtctc 672
           ||||||||||||||| |||||||| | || ||||||||||||| |||||||||||| |||
Sbjct: 331 aatgctcctcatggcttaaagctatccatagaagactacccttatgccaatgatggcctc 390

                                                                
Query: 673 attgtatgggatgccattaaacaatgggtcacggattatgtcaaccattacta 725
           ||| | |||||||| || |||   |||||||| |||||||| |||||||||||
Sbjct: 391 attctctgggatgctatcaaaagttgggtcactgattatgtgaaccattacta 443



 Score = 52.0 bits (26), Expect = 7e-06
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 358 attgcaacaaataggcaacttagtgccatgcacccaatctacaagttattgaatccacat 417
           ||||| ||||| |||||||| ||||| ||||| |||||||||| | |  || ||||||||
Sbjct: 76  attgccacaaacaggcaactgagtgcaatgcatccaatctacaggctgctgcatccacat 135

                                     
Query: 418 atgagatatactatggagatcaatgc 443
            | || || || ||||||||||||||
Sbjct: 136 tttaggtacacaatggagatcaatgc 161


>gnl|LJGI|TC79534 similar to UniRef100_A2TEX8 Cluster: Lipoxygenase; n=1; Phaseolus
           vulgaris|Rep: Lipoxygenase - Phaseolus vulgaris (Kidney
           bean) (French bean), partial (25%)
          Length = 685

 Score = 99.6 bits (50), Expect = 3e-20
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 613 aatgctcctcatggcctaaagctaacaattgaagactacccttttgccaatgatggtctc 672
           ||||||||||||||| |||||||| | || ||||||||||||| |||||||||||| |||
Sbjct: 576 aatgctcctcatggcttaaagctatccatagaagactacccttatgccaatgatggcctc 635

                                                             
Query: 673 attgtatgggatgccattaaacaatgggtcacggattatgtcaaccatta 722
           ||| | |||||||| || |||   |||||||| |||||||| ||||||||
Sbjct: 636 attctctgggatgctatcaaaagttgggtcactgattatgtgaaccatta 685



 Score = 77.8 bits (39), Expect = 1e-13
 Identities = 235/299 (78%), Gaps = 1/299 (0%)
 Strand = Plus / Plus

                                                                       
Query: 151 ggcacattgaagccactagctattgagctcactagaccagccatggatggtaagccacag 210
           |||||||||| |||||| ||||||||||| ||| | ||| | |||||||| ||||| || 
Sbjct: 113 ggcacattgaggccactggctattgagctaactcggccaccaatggatggaaagccgcaa 172

                                                                       
Query: 211 tggaaggaagtcttcacacctgctcctcattccactggtctttggctttggag-gtttgc 269
           |||| |||||| | ||||||| ||   || || |||    ||||||||||||| | ||||
Sbjct: 173 tggagggaagtgtacacaccttcttggcactcaacttccgtttggctttggagtgcttgc 232

                                                                       
Query: 270 caagactcatgttcttgcccatgattctggctatcatgaacttataagccattggttaag 329
           |||  ||||||| ||||| ||||| ||||| || ||  ||||| | || || ||| || |
Sbjct: 233 caaagctcatgtccttgcacatgactctggttaccaccaacttgttagtcactggctacg 292

                                                                       
Query: 330 gactcattgtgttatagaaccctttgtcattgcaacaaataggcaacttagtgccatgca 389
           |||||||||||  | |||||| |   | ||||| ||||| |||||||| ||||| |||||
Sbjct: 293 gactcattgtgcaacagaaccttacataattgccacaaacaggcaactgagtgcaatgca 352

                                                                      
Query: 390 cccaatctacaagttattgaatccacatatgagatatactatggagatcaatgcccttg 448
            |||||||||| | |  || |||||||| | || || || |||||||||||||| ||||
Sbjct: 353 tccaatctacaggctgctgcatccacattttaggtacacaatggagatcaatgctcttg 411