Miyakogusa Predicted Gene
- Lj6g3v1038780.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v1038780.1 tr|I1JFT4|I1JFT4_SOYBN Lipoxygenase OS=Glycine
max GN=Gma.53954 PE=3 SV=1,80.25,0,LIPOXYGENASE,Lipoxygenase,
C-terminal; Lipoxygenase,Lipoxygenase, C-terminal;
LIPOXYGENASE_2,Lipoxyg,CUFF.58797.1
(1002 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC68653 similar to UniRef100_A2TEX8 Cluster: Lipoxygena... 105 5e-22
gnl|LJGI|TC79534 similar to UniRef100_A2TEX8 Cluster: Lipoxygena... 100 3e-20
>gnl|LJGI|TC68653 similar to UniRef100_A2TEX8 Cluster: Lipoxygenase; n=1; Phaseolus
vulgaris|Rep: Lipoxygenase - Phaseolus vulgaris (Kidney
bean) (French bean), partial (37%)
Length = 1204
Score = 105 bits (53), Expect = 5e-22
Identities = 98/113 (86%)
Strand = Plus / Plus
Query: 613 aatgctcctcatggcctaaagctaacaattgaagactacccttttgccaatgatggtctc 672
||||||||||||||| |||||||| | || ||||||||||||| |||||||||||| |||
Sbjct: 331 aatgctcctcatggcttaaagctatccatagaagactacccttatgccaatgatggcctc 390
Query: 673 attgtatgggatgccattaaacaatgggtcacggattatgtcaaccattacta 725
||| | |||||||| || ||| |||||||| |||||||| |||||||||||
Sbjct: 391 attctctgggatgctatcaaaagttgggtcactgattatgtgaaccattacta 443
Score = 52.0 bits (26), Expect = 7e-06
Identities = 71/86 (82%)
Strand = Plus / Plus
Query: 358 attgcaacaaataggcaacttagtgccatgcacccaatctacaagttattgaatccacat 417
||||| ||||| |||||||| ||||| ||||| |||||||||| | | || ||||||||
Sbjct: 76 attgccacaaacaggcaactgagtgcaatgcatccaatctacaggctgctgcatccacat 135
Query: 418 atgagatatactatggagatcaatgc 443
| || || || ||||||||||||||
Sbjct: 136 tttaggtacacaatggagatcaatgc 161
>gnl|LJGI|TC79534 similar to UniRef100_A2TEX8 Cluster: Lipoxygenase; n=1; Phaseolus
vulgaris|Rep: Lipoxygenase - Phaseolus vulgaris (Kidney
bean) (French bean), partial (25%)
Length = 685
Score = 99.6 bits (50), Expect = 3e-20
Identities = 95/110 (86%)
Strand = Plus / Plus
Query: 613 aatgctcctcatggcctaaagctaacaattgaagactacccttttgccaatgatggtctc 672
||||||||||||||| |||||||| | || ||||||||||||| |||||||||||| |||
Sbjct: 576 aatgctcctcatggcttaaagctatccatagaagactacccttatgccaatgatggcctc 635
Query: 673 attgtatgggatgccattaaacaatgggtcacggattatgtcaaccatta 722
||| | |||||||| || ||| |||||||| |||||||| ||||||||
Sbjct: 636 attctctgggatgctatcaaaagttgggtcactgattatgtgaaccatta 685
Score = 77.8 bits (39), Expect = 1e-13
Identities = 235/299 (78%), Gaps = 1/299 (0%)
Strand = Plus / Plus
Query: 151 ggcacattgaagccactagctattgagctcactagaccagccatggatggtaagccacag 210
|||||||||| |||||| ||||||||||| ||| | ||| | |||||||| ||||| ||
Sbjct: 113 ggcacattgaggccactggctattgagctaactcggccaccaatggatggaaagccgcaa 172
Query: 211 tggaaggaagtcttcacacctgctcctcattccactggtctttggctttggag-gtttgc 269
|||| |||||| | ||||||| || || || ||| ||||||||||||| | ||||
Sbjct: 173 tggagggaagtgtacacaccttcttggcactcaacttccgtttggctttggagtgcttgc 232
Query: 270 caagactcatgttcttgcccatgattctggctatcatgaacttataagccattggttaag 329
||| ||||||| ||||| ||||| ||||| || || ||||| | || || ||| || |
Sbjct: 233 caaagctcatgtccttgcacatgactctggttaccaccaacttgttagtcactggctacg 292
Query: 330 gactcattgtgttatagaaccctttgtcattgcaacaaataggcaacttagtgccatgca 389
||||||||||| | |||||| | | ||||| ||||| |||||||| ||||| |||||
Sbjct: 293 gactcattgtgcaacagaaccttacataattgccacaaacaggcaactgagtgcaatgca 352
Query: 390 cccaatctacaagttattgaatccacatatgagatatactatggagatcaatgcccttg 448
|||||||||| | | || |||||||| | || || || |||||||||||||| ||||
Sbjct: 353 tccaatctacaggctgctgcatccacattttaggtacacaatggagatcaatgctcttg 411