Miyakogusa Predicted Gene

Lj6g3v0925660.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0925660.2 Non Chatacterized Hit- tr|I1KY35|I1KY35_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.45513
PE,63.99,0,PIF1,DNA helicase PIF1, ATP-dependent; SUBFAMILY NOT
NAMED,NULL; DNA HELICASE-RELATED,NULL,CUFF.58561.2
         (1054 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC68465 weakly similar to UniRef100_Q6CWC6 Cluster: Klu...    72   8e-12
gnl|LJGI|TC57674 weakly similar to UniRef100_A8BBU9 Cluster: Rrm...    72   8e-12

>gnl|LJGI|TC68465 weakly similar to UniRef100_Q6CWC6 Cluster: Kluyveromyces lactis
           strain NRRL Y-1140 chromosome B of strain NRRL Y- 1140
           of Kluyveromyces lactis; n=1; Kluyveromyces lactis|Rep:
           Kluyveromyces lactis strain NRRL Y-1140 chromosome B of
           strain NRRL Y- 1140 of Kluyveromyces lactis -
           Kluyveromyces lactis (Yeast) (Candida sphaerica),
           partial (12%)
          Length = 894

 Score = 71.9 bits (36), Expect = 8e-12
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                       
Query: 147 gtatgcatttgatgctgattgttggaatgacagctttgatttgcaggtggagctcacgag 206
           |||||| ||||| ||||||||||||||||||||||||  ||||||||| ||||| || ||
Sbjct: 788 gtatgcttttgaagctgattgttggaatgacagctttagtttgcaggtagagcttactag 847

                       
Query: 207 ggtgttcaggca 218
           | | ||||||||
Sbjct: 848 gatcttcaggca 859


>gnl|LJGI|TC57674 weakly similar to UniRef100_A8BBU9 Cluster: Rrm3p helicase; n=1;
           Giardia lamblia ATCC 50803|Rep: Rrm3p helicase - Giardia
           lamblia ATCC 50803, partial (8%)
          Length = 858

 Score = 71.9 bits (36), Expect = 8e-12
 Identities = 69/80 (86%)
 Strand = Plus / Plus

                                                                       
Query: 706 gttgttgcttgcaggaagcaggttcctcttatactggcatgggctatgagcattcacaag 765
           ||||||||| | ||||||||| | || |||||| ||||||||||| ||||||| ||||||
Sbjct: 204 gttgttgctaggaggaagcagataccacttatattggcatgggctctgagcatccacaag 263

                               
Query: 766 tgccaagggatgactcttga 785
           ||||| || |||| ||||||
Sbjct: 264 tgccagggaatgaatcttga 283