Miyakogusa Predicted Gene
- Lj6g3v0920000.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v0920000.1 Non Chatacterized Hit- tr|K4BQJ4|K4BQJ4_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,38.82,1e-18,FAMILY NOT NAMED,NULL; PMD,Aminotransferase-like,
plant mobile domain,CUFF.58477.1
(831 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|AV776708 similar to UniRef100_O34071 Cluster: ORF40; n=... 62 6e-09
gnl|LJGI|TC68910 54 1e-06
>gnl|LJGI|AV776708 similar to UniRef100_O34071 Cluster: ORF40; n=1; Streptococcus
phage O1205|Rep: ORF40 - Streptococcus phage O1205,
partial (1%)
Length = 603
Score = 61.9 bits (31), Expect = 6e-09
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 574 aaatcttgtgatgatggttcaaaaactgtggaggttgataatgatgccgatgttacttct 633
||||||| |||||||||||||| || |||| ||||||| |||||||| |||||| | ||
Sbjct: 509 aaatcttttgatgatggttcaagaagtgtgaaggttgagaatgatgcagatgttccacct 450
Query: 634 ggttttcttcc 644
|| ||||||||
Sbjct: 449 gggtttcttcc 439
>gnl|LJGI|TC68910
Length = 656
Score = 54.0 bits (27), Expect = 1e-06
Identities = 48/55 (87%)
Strand = Plus / Plus
Query: 637 tttcttcctaatcatttgcaagttgtcccttttggaaattctgttcaagatggtt 691
||||||||||||| |||| || ||| |||| ||| |||||||||||||||||||
Sbjct: 215 tttcttcctaatcgtttgaaaaatgttccttctgggaattctgttcaagatggtt 269