Miyakogusa Predicted Gene
- Lj6g3v0918820.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v0918820.1 tr|Q8RXC3|Q8RXC3_ARATH Aminotransferase-like,
plant mobile domain family protein OS=Arabidopsis
thal,42.54,2e-19,PMD,Aminotransferase-like, plant mobile domain;
seg,NULL; FAMILY NOT NAMED,NULL,CUFF.58455.1
(402 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC79106 60 1e-08
>gnl|LJGI|TC79106
Length = 985
Score = 60.0 bits (30), Expect = 1e-08
Identities = 57/66 (86%)
Strand = Plus / Plus
Query: 14 tcacactgtgggctccttttcagctggtccaagtgtgggctttggagagatttccagcac 73
|||| |||||||| ||||||||| | || ||| | |||||| ||||||| ||||||||||
Sbjct: 12 tcactctgtgggcaccttttcaggttgtgcaaatatgggctatggagaggtttccagcac 71
Query: 74 tgcagc 79
||||||
Sbjct: 72 tgcagc 77