Miyakogusa Predicted Gene

Lj6g3v0779770.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0779770.1 Non Chatacterized Hit- tr|I1M9J8|I1M9J8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.50053
PE,78.33,0,Cytochrome P450,Cytochrome P450; seg,NULL;
EP450I,Cytochrome P450, E-class, group I;
P450,Cytochrome,NODE_92743_length_801_cov_7.956305.path2.1
         (541 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO016191 weakly similar to UniRef100_A7Q952 Cluster: Ch...   400   e-111
gnl|LJGI|TC59879 UniRef100_O22307 Cluster: Cytochrome P450 71D11...   143   1e-33
gnl|LJGI|TC67691 weakly similar to UniRef100_O22307 Cluster: Cyt...    60   1e-08
gnl|LJGI|TC82527 similar to UniRef100_O81974 Cluster: Cytochrome...    56   2e-07
gnl|LJGI|GO010417 weakly similar to UniRef100_O22307 Cluster: Cy...    54   9e-07
gnl|LJGI|FS344774 similar to UniRef100_Q2LAK5 Cluster: Cytochrom...    52   4e-06
gnl|LJGI|TC58106 weakly similar to UniRef100_O81974 Cluster: Cyt...    52   4e-06

>gnl|LJGI|GO016191 weakly similar to UniRef100_A7Q952 Cluster: Chromosome chr19
           scaffold_66, whole genome shotgun sequence; n=1; Vitis
           vinifera|Rep: Chromosome chr19 scaffold_66, whole genome
           shotgun sequence - Vitis vinifera (Grape), partial (36%)
          Length = 914

 Score =  400 bits (202), Expect = e-111
 Identities = 443/522 (84%), Gaps = 1/522 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   atggcagaaatggtaagggatccaagagtaatgaagaaagcacaagctgaggtgagagag 60
           |||||||| |||| |||| | ||||||||||||||||||||||||| |||||||||||||
Sbjct: 893 atggcagagatggcaagg-acccaagagtaatgaagaaagcacaagttgaggtgagagag 835

                                                                       
Query: 61  gttttcaatatgaaagggaaggttgatgaacattgtaccaatgagctcaaatatttgaag 120
           || |||||||||||||| | ||| |||||| |||| |  ||||| |||||||||||||| 
Sbjct: 834 gtattcaatatgaaaggaagggtggatgaaaattgcattaatgaactcaaatatttgaaa 775

                                                                       
Query: 121 tcagttatcaaagagaccctgaggttgcaccctccagcacctcttttgcttccaagagaa 180
           |||||| ||||||||||| | || || ||||||||||| || ||||| ||||||||||||
Sbjct: 774 tcagttgtcaaagagaccttaagattacaccctccagctccacttttacttccaagagaa 715

                                                                       
Query: 181 tgcggtcaagcatgtgagatacatggttatcacataccagccaaaagtaaagtcatagtc 240
           || || |||||||||||||| || || ||||| |||||||| |||||||| ||||| |||
Sbjct: 714 tgtggacaagcatgtgagattcaagggtatcatataccagcaaaaagtaaggtcattgtc 655

                                                                       
Query: 241 aatgcttgggcaattggaagagattcaaactattggactgaaccagagaggttttatcct 300
           ||||||||||| |||||||||||| |||  || |||| ||||||||| || |||||||| 
Sbjct: 654 aatgcttgggccattggaagagatccaagatactggagtgaaccagaaagattttatcca 595

                                                                       
Query: 301 gagagattcattgatagcactattgattacaaagggaatgattttgagtacattcctttt 360
           ||||||||||||| |||| ||||||| |||||||||  | |||||||||||||||| |||
Sbjct: 594 gagagattcattggtagctctattgactacaaagggggtaattttgagtacattccattt 535

                                                                       
Query: 361 ggtgctggaagaagaatatgcccaggtagcacatttggtctgagaagtattgagttgggc 420
           ||||||||||||||||||||||| || | |||||||||| | |  | | ||||| |||  
Sbjct: 534 ggtgctggaagaagaatatgccctggaaccacatttggtttaatcaatgttgaggtggct 475

                                                                       
Query: 421 ctttcaatgttgttgtatcattttgattggaagcttcccggtggaatcagaagtgaagaa 480
           ||| ||   ||||||||||| ||||||||||| || |||  |||||| | | |||| || 
Sbjct: 474 cttgcatctttgttgtatcactttgattggaacctgcccaatggaatgaaatgtgaggag 415

                                                     
Query: 481 ttggacatgactgaggaatttggagtcacagtaagaagaaaa 522
           ||||||||||||||| ||||||||| |||  | |||||||||
Sbjct: 414 ttggacatgactgagcaatttggagccaccattagaagaaaa 373


>gnl|LJGI|TC59879 UniRef100_O22307 Cluster: Cytochrome P450 71D11; n=1; Lotus
            japonicus|Rep: Cytochrome P450 71D11 - Lotus japonicus,
            complete
          Length = 1757

 Score =  143 bits (72), Expect = 1e-33
 Identities = 168/200 (84%)
 Strand = Plus / Plus

                                                                        
Query: 187  caagcatgtgagatacatggttatcacataccagccaaaagtaaagtcatagtcaatgct 246
            ||||| ||||||||  |||||||||| ||||| || ||||| |  ||| |||||||| ||
Sbjct: 1163 caagcttgtgagattaatggttatcatatacctgcaaaaagcacggtcttagtcaatact 1222

                                                                        
Query: 247  tgggcaattggaagagattcaaactattggactgaaccagagaggttttatcctgagaga 306
            |  |||||||||| ||||||||| |||||| |||||||||||||||||| |||||| || 
Sbjct: 1223 tttgcaattggaacagattcaaaatattgggctgaaccagagaggttttgtcctgaaagg 1282

                                                                        
Query: 307  ttcattgatagcactattgattacaaagggaatgattttgagtacattccttttggtgct 366
            || ||||||||| ||||||| |||||||| | | |||||||| |  | || |||||||||
Sbjct: 1283 tttattgatagctctattgactacaaaggaactaattttgagcatctcccatttggtgct 1342

                                
Query: 367  ggaagaagaatatgcccagg 386
            ||||| ||||| ||||||||
Sbjct: 1343 ggaaggagaatttgcccagg 1362


>gnl|LJGI|TC67691 weakly similar to UniRef100_O22307 Cluster: Cytochrome P450 71D11;
           n=1; Lotus japonicus|Rep: Cytochrome P450 71D11 - Lotus
           japonicus, partial (44%)
          Length = 903

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 117/146 (80%)
 Strand = Plus / Plus

                                                                       
Query: 241 aatgcttgggcaattggaagagattcaaactattggactgaaccagagaggttttatcct 300
           |||||||||||||||| ||| ||| | || |||||| ||||||| || |||| ||| |||
Sbjct: 458 aatgcttgggcaattgcaagggatcctaaatattggcctgaaccggataggtcttaccct 517

                                                                       
Query: 301 gagagattcattgatagcactattgattacaaagggaatgattttgagtacattcctttt 360
           || || || ||   |||| ||||| | | || ||| |||||||||||||| || || |||
Sbjct: 518 gaaaggtttatcagtagctctattaacttcataggaaatgattttgagtatatcccattt 577

                                     
Query: 361 ggtgctggaagaagaatatgcccagg 386
           ||||| |||| |||||| || |||||
Sbjct: 578 ggtgccggaaaaagaatttgtccagg 603


>gnl|LJGI|TC82527 similar to UniRef100_O81974 Cluster: Cytochrome P450 71D8; n=1;
            Glycine max|Rep: Cytochrome P450 71D8 - Glycine max
            (Soybean), partial (54%)
          Length = 1351

 Score = 56.0 bits (28), Expect = 2e-07
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                    
Query: 331  aaagggaatgattttgagtacattccttttggtgctggaagaagaatatgcccagg 386
            ||||||||| | ||||||||||| |||||||| || ||||| |||||||| |||||
Sbjct: 1035 aaagggaataactttgagtacatcccttttggggcaggaaggagaatatgtccagg 1090


>gnl|LJGI|GO010417 weakly similar to UniRef100_O22307 Cluster: Cytochrome P450 71D11;
           n=1; Lotus japonicus|Rep: Cytochrome P450 71D11 - Lotus
           japonicus, partial (38%)
          Length = 645

 Score = 54.0 bits (27), Expect = 9e-07
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 20  atccaagagtaatgaagaaagcacaagctgaggtgagagaggt 62
           |||||||| || ||||||||||||||| ||| |||||||||||
Sbjct: 545 atccaagaatattgaagaaagcacaagttgaagtgagagaggt 587


>gnl|LJGI|FS344774 similar to UniRef100_Q2LAK5 Cluster: Cytochrome P450 monooxygenase
           CYP71D54; n=1; Glycine max|Rep: Cytochrome P450
           monooxygenase CYP71D54 - Glycine max (Soybean), partial
           (60%)
          Length = 717

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 331 aaagggaatgattttgagtacattccttttggtgctggaagaagaatatg 380
           ||||||||| | ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 603 aaagggaataactttgagtacatcccttttggggcaggaaggagaatatg 652


>gnl|LJGI|TC58106 weakly similar to UniRef100_O81974 Cluster: Cytochrome P450 71D8;
           n=1; Glycine max|Rep: Cytochrome P450 71D8 - Glycine max
           (Soybean), partial (38%)
          Length = 929

 Score = 52.0 bits (26), Expect = 4e-06
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 331 aaagggaatgattttgagtacattccttttggtgctggaagaagaatatg 380
           ||||||||| | ||||||||||| |||||||| || ||||| ||||||||
Sbjct: 493 aaagggaataactttgagtacatcccttttggggcaggaaggagaatatg 542