Miyakogusa Predicted Gene

Lj6g3v0528400.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0528400.1 Non Chatacterized Hit- tr|I1MU62|I1MU62_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.42558
PE,97.56,0,SUBFAMILY NOT NAMED,NULL; FAMILY NOT NAMED,NULL;
PROTEIN_KINASE_ST,Serine/threonine-protein kinase,
,NODE_4626_length_740_cov_87.191895.path2.1
         (369 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62983                                                      149   1e-35
gnl|LJGI|TC66119 similar to UniRef100_A7QPC2 Cluster: Chromosome...    68   4e-11
gnl|LJGI|TC65945 similar to UniRef100_A7QPC2 Cluster: Chromosome...    68   4e-11
gnl|LJGI|BW624909 homologue to UniRef100_Q84QD9 Cluster: Avr9/Cf...    66   2e-10
gnl|LJGI|TC74279 similar to UniRef100_Q5XWQ1 Cluster: Serine/thr...    62   3e-09
gnl|LJGI|TC69630 similar to UniRef100_A7PN67 Cluster: Chromosome...    54   6e-07
gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinas...    54   6e-07
gnl|LJGI|TC81310 similar to UniRef100_Q9ZT08 Cluster: Receptor-l...    52   2e-06
gnl|LJGI|TC59486 similar to UniRef100_A7PDW6 Cluster: Chromosome...    52   2e-06

>gnl|LJGI|TC62983 
          Length = 695

 Score =  149 bits (75), Expect = 1e-35
 Identities = 75/75 (100%)
 Strand = Plus / Plus

                                                                       
Query: 295 ggacacttgacttcaaaaagtgatgtttatagctttggagttgtgttgcttgagatttta 354
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 253 ggacacttgacttcaaaaagtgatgtttatagctttggagttgtgttgcttgagatttta 312

                          
Query: 355 acaggaagaagatcg 369
           |||||||||||||||
Sbjct: 313 acaggaagaagatcg 327


>gnl|LJGI|TC66119 similar to UniRef100_A7QPC2 Cluster: Chromosome chr18 scaffold_137,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_137, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (46%)
          Length = 767

 Score = 67.9 bits (34), Expect = 4e-11
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 127 gtcatctacagagatttcaaaacatcaaacattttgcttgatacggagtataatgcaaag 186
           ||||||||||||||||||||  | || |||||||| ||||||| ||| |  |||||||||
Sbjct: 682 gtcatctacagagatttcaagtcctccaacattttacttgatagggatttcaatgcaaag 741

                         
Query: 187 ctttcagattttgg 200
           ||||| ||||||||
Sbjct: 742 ctttccgattttgg 755


>gnl|LJGI|TC65945 similar to UniRef100_A7QPC2 Cluster: Chromosome chr18 scaffold_137,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr18 scaffold_137, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (83%)
          Length = 1516

 Score = 67.9 bits (34), Expect = 4e-11
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 127 gtcatctacagagatttcaaaacatcaaacattttgcttgatacggagtataatgcaaag 186
           ||||||||||||||||||||  | || |||||||| ||||||| ||| |  |||||||||
Sbjct: 624 gtcatctacagagatttcaagtcctccaacattttacttgatagggatttcaatgcaaag 683

                         
Query: 187 ctttcagattttgg 200
           ||||| ||||||||
Sbjct: 684 ctttccgattttgg 697


>gnl|LJGI|BW624909 homologue to UniRef100_Q84QD9 Cluster: Avr9/Cf-9 induced kinase 1;
           n=1; Nicotiana tabacum|Rep: Avr9/Cf-9 induced kinase 1 -
           Nicotiana tabacum (Common tobacco), partial (35%)
          Length = 477

 Score = 65.9 bits (33), Expect = 2e-10
 Identities = 162/205 (79%)
 Strand = Plus / Plus

                                                                       
Query: 122 aaccagtcatctacagagatttcaaaacatcaaacattttgcttgatacggagtataatg 181
           ||||||||||||| || ||||||||| | |||||||| ||| | ||  | ||  | ||||
Sbjct: 270 aaccagtcatctatagggatttcaaagcttcaaacatcttgttagactctgaccacaatg 329

                                                                       
Query: 182 caaagctttcagattttggtctagcaaaagcaggccctcagggggacaaaacacatgttt 241
           ||||||| || ||||||||  | |||||||  || ||| | || ||  | ||||||||||
Sbjct: 330 caaagctctctgattttgggttggcaaaagatggtcctgaaggagatgacacacatgttt 389

                                                                       
Query: 242 ctactagagttgttggcacttatggttatgctgctccagaatacgtcatgacaggacact 301
           | ||||||||| | |||||  | || ||||| || ||||||||| ||||||||||||| |
Sbjct: 390 ccactagagttatgggcacacaagggtatgcagcaccagaatacatcatgacaggacatt 449

                                    
Query: 302 tgacttcaaaaagtgatgtttatag 326
           ||||  |||  |||||||| |||||
Sbjct: 450 tgacagcaatgagtgatgtgtatag 474


>gnl|LJGI|TC74279 similar to UniRef100_Q5XWQ1 Cluster: Serine/threonine protein
           kinase-like; n=1; Solanum tuberosum|Rep:
           Serine/threonine protein kinase-like - Solanum tuberosum
           (Potato), partial (33%)
          Length = 921

 Score = 61.9 bits (31), Expect = 3e-09
 Identities = 151/191 (79%)
 Strand = Plus / Plus

                                                                       
Query: 178 aatgcaaagctttcagattttggtctagcaaaagcaggccctcagggggacaaaacacat 237
           ||||| ||||| ||||| ||||| || |||||||  || ||  |||| || ||||| |||
Sbjct: 11  aatgccaagctctcagactttggacttgcaaaagatggtccagagggtgataaaacccat 70

                                                                       
Query: 238 gtttctactagagttgttggcacttatggttatgctgctccagaatacgtcatgacagga 297
           || |||||| ||||  | || |||||||||||||| || || ||||| ||| ||||||||
Sbjct: 71  gtgtctactcgagtgatgggaacttatggttatgcagcacctgaatatgtcgtgacagga 130

                                                                       
Query: 298 cacttgacttcaaaaagtgatgtttatagctttggagttgtgttgcttgagattttaaca 357
           ||  | || |||| |||||| || ||||| |||||||| ||| | || ||||| || || 
Sbjct: 131 catcttacatcaagaagtgacgtgtatagttttggagtggtgcttctggagatgttgact 190

                      
Query: 358 ggaagaagatc 368
           || ||||||||
Sbjct: 191 ggcagaagatc 201


>gnl|LJGI|TC69630 similar to UniRef100_A7PN67 Cluster: Chromosome chr1 scaffold_22,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr1 scaffold_22, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (15%)
          Length = 671

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 310 aaaagtgatgtttatagctttggagttgtgttgct 344
           |||||||||||||||||||||||||| ||| ||||
Sbjct: 150 aaaagtgatgtttatagctttggagtggtgctgct 184


>gnl|LJGI|TC61612 similar to UniRef100_Q9LKY3 Cluster: Pti1 kinase-like protein; n=1;
           Glycine max|Rep: Pti1 kinase-like protein - Glycine max
           (Soybean), complete
          Length = 1554

 Score = 54.0 bits (27), Expect = 6e-07
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 304 acttcaaaaagtgatgtttatagctttggagttgt 338
           |||||||||||||||||||| || |||||||||||
Sbjct: 931 acttcaaaaagtgatgtttacagttttggagttgt 965


>gnl|LJGI|TC81310 similar to UniRef100_Q9ZT08 Cluster: Receptor-like protein kinase;
           n=1; Arabidopsis thaliana|Rep: Receptor-like protein
           kinase - Arabidopsis thaliana (Mouse-ear cress), partial
           (14%)
          Length = 1152

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 1   atgacccgtggcagtctagaaaatcatctattcagaag 38
           ||||||||||| |||||||| |||| ||||||||||||
Sbjct: 496 atgacccgtggaagtctagacaatcttctattcagaag 533


>gnl|LJGI|TC59486 similar to UniRef100_A7PDW6 Cluster: Chromosome chr11 scaffold_13,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr11 scaffold_13, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (42%)
          Length = 895

 Score = 52.0 bits (26), Expect = 2e-06
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 122 aaccagtcatctacagagatttcaaa 147
           ||||||||||||||||||||||||||
Sbjct: 828 aaccagtcatctacagagatttcaaa 853