Miyakogusa Predicted Gene

Lj6g3v0468400.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0468400.1 Non Chatacterized Hit- tr|I1JRF3|I1JRF3_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.34733
PE,90.91,0.00000000000004,seg,NULL,104393_g.1
         (133 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC78775 similar to UniRef100_Q84L60 Cluster: Branched-c...   264   1e-70

>gnl|LJGI|TC78775 similar to UniRef100_Q84L60 Cluster: Branched-chain amino acid
           aminotransferase-like protein; n=1; Cicer arietinum|Rep:
           Branched-chain amino acid aminotransferase-like protein
           - Cicer arietinum (Chickpea) (Garbanzo), partial (97%)
          Length = 1899

 Score =  264 bits (133), Expect = 1e-70
 Identities = 133/133 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcttcggcgccatgtgaagaagaagtcatctcttttgagccctcctttacctcctcct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 852 atgcttcggcgccatgtgaagaagaagtcatctcttttgagccctcctttacctcctcct 911

                                                                       
Query: 61  gatcttccagttcctgcaaatgagaaattgcttgcttgggttggtgatgagattgtgcca 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 912 gatcttccagttcctgcaaatgagaaattgcttgcttgggttggtgatgagattgtgcca 971

                        
Query: 121 cgcgagaatgcaa 133
           |||||||||||||
Sbjct: 972 cgcgagaatgcaa 984