Miyakogusa Predicted Gene

Lj6g3v0437540.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0437540.1 tr|G7IP58|G7IP58_MEDTR F-box protein SKIP19
OS=Medicago truncatula GN=MTR_2g019060 PE=4
SV=1,43.51,3e-19,RNI-like,NULL; no description,NULL; N7-RELATED
PROTEIN,NULL; F-BOX/LEUCINE RICH REPEAT PROTEIN,NULL,CUFF.57878.1
         (411 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 ...   347   3e-95
gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-lik...    94   8e-19
gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc...    60   1e-08
gnl|LJGI|AV774423                                                      52   3e-06
gnl|LJGI|TC75820 weakly similar to UniRef100_Q2HSK3 Cluster: Cyc...    52   3e-06

>gnl|LJGI|TC80874 weakly similar to UniRef100_O82023 Cluster: N7 protein; n=1;
           Medicago truncatula|Rep: N7 protein - Medicago
           truncatula (Barrel medic), partial (34%)
          Length = 1017

 Score =  347 bits (175), Expect = 3e-95
 Identities = 235/255 (92%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgaggggactgaaaggctttgaatgtgatgatgaggcatttgctattgcaaaaaccatg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 627 atgaggggactgaaaggctttgaatgtgatgatgaggcatttgctattgcaaaaaccatg 686

                                                                       
Query: 61  cctcagctgtgtcatcttcagcttttgggaaacaggctcactaatgaaggcttgcttgcc 120
           ||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||| 
Sbjct: 687 cctcagctgtgtcatcttcagcttttgggaaacaggctcactaataacggcttgattgct 746

                                                                       
Query: 121 attcttgatggatgccctcatctggaatctcttgacctgcgtgtttgctctaatgtcgat 180
           ||||||||||| ||||||||||| ||||||||||||||||||| ||| |||||||| | |
Sbjct: 747 attcttgatgggtgccctcatcttgaatctcttgacctgcgtgcttgttctaatgttgtt 806

                                                                       
Query: 181 ttgagcggaagtttgagggaaaggtgtcttaagcaaataaaagatttacgtcttccagaa 240
            |||| ||||| |||| |||||||||||||||||| || |||||||||||||||||||  
Sbjct: 807 ctgagtggaagattgaaggaaaggtgtcttaagcagatcaaagatttacgtcttccaggg 866

                          
Query: 241 gacttgagtgaagtt 255
           ||  |||||||||||
Sbjct: 867 gatgtgagtgaagtt 881


>gnl|LJGI|TC63939 similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (37%)
          Length = 840

 Score = 93.7 bits (47), Expect = 8e-19
 Identities = 101/119 (84%)
 Strand = Plus / Plus

                                                                       
Query: 40  tttgctattgcaaaaaccatgcctcagctgtgtcatcttcagcttttgggaaacaggctc 99
           |||| ||| ||| |||| |||||| ||||| |||| || ||| || |||||||||| |||
Sbjct: 327 tttgttatagcagaaacaatgcctgagctgcgtcacctacagattatgggaaacagtctc 386

                                                                      
Query: 100 actaatgaaggcttgcttgccattcttgatggatgccctcatctggaatctcttgacct 158
           | |||||| ||||||||||| ||||||||||| ||||||| ||| |||| |||||||||
Sbjct: 387 agtaatgatggcttgcttgctattcttgatggttgccctcttctcgaatatcttgacct 445


>gnl|LJGI|TC70271 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (28%)
          Length = 823

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 102 taatgaaggcttgcttgccattcttgatggatgccctcatctggaatctcttgacctg 159
           |||||||||||||  ||||||||||||||| || |||| ||| |||| ||||||||||
Sbjct: 369 taatgaaggcttggatgccattcttgatggttgtcctcttcttgaatatcttgacctg 426


>gnl|LJGI|AV774423 
          Length = 394

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 181 ttgagcggaagtttgagggaaaggtgtcttaagcaaat 218
           ||||||||||||||| |||||||||||  |||||||||
Sbjct: 322 ttgagcggaagtttgggggaaaggtgttataagcaaat 285


>gnl|LJGI|TC75820 weakly similar to UniRef100_Q2HSK3 Cluster: Cyclin-like F-box; n=1;
           Medicago truncatula|Rep: Cyclin-like F-box - Medicago
           truncatula (Barrel medic), partial (13%)
          Length = 505

 Score = 52.0 bits (26), Expect = 3e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 181 ttgagcggaagtttgagggaaaggtgtcttaagcaaat 218
           ||||||||||||||| |||||||||||  |||||||||
Sbjct: 216 ttgagcggaagtttgggggaaaggtgttataagcaaat 253