Miyakogusa Predicted Gene
- Lj6g3v0437220.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v0437220.1 Non Chatacterized Hit- tr|Q0RU40|Q0RU40_FRAAA
Putative uncharacterized protein OS=Frankia alni
(stra,53.33,0.52,seg,NULL,CUFF.57849.1
(403 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC597923 similar to UniRef100_Q67966 Cluster: Core prot... 54 7e-07
>gnl|LJGI|DC597923 similar to UniRef100_Q67966 Cluster: Core protein; n=3; Hepatitis B
virus|Rep: Core protein - Hepatitis B virus (HBV),
partial (9%)
Length = 573
Score = 54.0 bits (27), Expect = 7e-07
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 27 aaattgccctcaaaattgtaaaattaggttaaaatttgagggtacttttggaatttcgc 85
|||||||||| ||||| || |||||||||||| |||||||| | |||||| |||||||
Sbjct: 279 aaattgcccttgaaattttataattaggttaaactttgagggcaattttgggatttcgc 221