Miyakogusa Predicted Gene

Lj6g3v0326340.2
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0326340.2 Non Chatacterized Hit- tr|I1MZQ0|I1MZQ0_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=3,80.14,0,p450,Cytochrome P450; Cytochrome P450,Cytochrome P450; no
description,Cytochrome P450; SUBFAMILY NOT,CUFF.57713.2
         (1017 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC77918 similar to UniRef100_A7Q3V8 Cluster: Chromosome...   545   e-154

>gnl|LJGI|TC77918 similar to UniRef100_A7Q3V8 Cluster: Chromosome chr13 scaffold_48,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr13 scaffold_48, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (14%)
          Length = 846

 Score =  545 bits (275), Expect = e-154
 Identities = 275/275 (100%)
 Strand = Plus / Plus

                                                                       
Query: 684 ccaaagagcaagggcaagaattgttgataggacacttcaaattatgaacattagaaggga 743
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   ccaaagagcaagggcaagaattgttgataggacacttcaaattatgaacattagaaggga 60

                                                                       
Query: 744 ggaacttgcaaaaggaactctaagctctaccaatgatatgctttctggcctgcttgcatt 803
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61  ggaacttgcaaaaggaactctaagctctaccaatgatatgctttctggcctgcttgcatt 120

                                                                       
Query: 804 aagggatgaaaatcaccaacctctagctgatgacataatcactgacaatttcattctttt 863
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 aagggatgaaaatcaccaacctctagctgatgacataatcactgacaatttcattctttt 180

                                                                       
Query: 864 atttgttgcaagccatgacacttctgctactcttatgagcttgatgatatggaagttatc 923
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 atttgttgcaagccatgacacttctgctactcttatgagcttgatgatatggaagttatc 240

                                              
Query: 924 tagagatcccgaggtttacaaaaaagtcttagaag 958
           |||||||||||||||||||||||||||||||||||
Sbjct: 241 tagagatcccgaggtttacaaaaaagtcttagaag 275