Miyakogusa Predicted Gene

Lj6g3v0183570.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0183570.1 Non Chatacterized Hit- tr|A5BFT3|A5BFT3_VITVI
Putative uncharacterized protein OS=Vitis vinifera
GN=,38.89,0.000000000000004,seg,NULL,gene.g63918.t1.1
         (999 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO038706                                                      54   2e-06

>gnl|LJGI|GO038706 
          Length = 753

 Score = 54.0 bits (27), Expect = 2e-06
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 722 ttagtgtcagccaatttgctagggataatagagtcttttttgagtttcatc 772
           ||||||| ||| |||||||||  |||||| ||||||||||||| |||||||
Sbjct: 395 ttagtgttagcaaatttgctaaagataatggagtcttttttgaatttcatc 345