Miyakogusa Predicted Gene
- Lj6g3v0043500.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v0043500.1 Non Chatacterized Hit- tr|I1NI15|I1NI15_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,76.41,0,AF0104/ALDC/Ptd012-like,NULL; seg,NULL; DUF296,Domain of
unknown function DUF296; no
description,NUL,NODE_3697_length_1606_cov_318.390411.path2.1
(582 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC75749 similar to UniRef100_A1DR81 Cluster: AT-hook DN... 531 e-150
gnl|LJGI|TC68245 similar to UniRef100_A7QMS0 Cluster: Chromosome... 172 2e-42
>gnl|LJGI|TC75749 similar to UniRef100_A1DR81 Cluster: AT-hook DNA-binding protein;
n=1; Catharanthus roseus|Rep: AT-hook DNA-binding
protein - Catharanthus roseus (Rosy periwinkle)
(Madagascar periwinkle), partial (55%)
Length = 628
Score = 531 bits (268), Expect = e-150
Identities = 268/268 (100%)
Strand = Plus / Plus
Query: 1 atggaggtggccggaggagctgatgttgctgagagcgtggcgcagttcgcgaggcggcgc 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 atggaggtggccggaggagctgatgttgctgagagcgtggcgcagttcgcgaggcggcgc 420
Query: 61 cagcgcggggtttgcgttcttagcgggagtggcgctgtggccaatgttaccctacgtcag 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 cagcgcggggtttgcgttcttagcgggagtggcgctgtggccaatgttaccctacgtcag 480
Query: 121 cctgcggcgccgggagctgtggtggcgcttcatggaaggtttgagatcttgtccttaact 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481 cctgcggcgccgggagctgtggtggcgcttcatggaaggtttgagatcttgtccttaact 540
Query: 181 ggggcttttcttcctggacctgctcctccaggctccacaggactcacagtgtaccttgct 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541 ggggcttttcttcctggacctgctcctccaggctccacaggactcacagtgtaccttgct 600
Query: 241 ggaggacagggacaggttgtgggaggga 268
||||||||||||||||||||||||||||
Sbjct: 601 ggaggacagggacaggttgtgggaggga 628
>gnl|LJGI|TC68245 similar to UniRef100_A7QMS0 Cluster: Chromosome undetermined
scaffold_127, whole genome shotgun sequence; n=2; Vitis
vinifera|Rep: Chromosome undetermined scaffold_127,
whole genome shotgun sequence - Vitis vinifera (Grape),
partial (42%)
Length = 808
Score = 172 bits (87), Expect = 2e-42
Identities = 201/239 (84%)
Strand = Plus / Plus
Query: 130 ccgggagctgtggtggcgcttcatggaaggtttgagatcttgtccttaactggggctttt 189
||||| ||||| || || || ||||| |||||||||||||| ||| |||||||||| ||
Sbjct: 1 ccgggtgctgttgtagcactccatggtaggtttgagatcttatccctaactggggcgttc 60
Query: 190 cttcctggacctgctcctccaggctccacaggactcacagtgtaccttgctggaggacag 249
|| ||||| |||||||||||||| ||||| || || |||||||| ||| |||||||||||
Sbjct: 61 ctacctggccctgctcctccaggatccactggtctaacagtgtatctttctggaggacag 120
Query: 250 ggacaggttgtgggagggagtgttgttggatctttagttgctgctggacctgtcatggtg 309
|| ||||| |||||||||||||| || || ||| ||||||| || ||||| || |||||
Sbjct: 121 ggtcaggtagtgggagggagtgtggtggggtctctagttgcagcaggaccagttatggtc 180
Query: 310 attgctgctacttttgccaatgctacttatgagagactgccccttgaggaggatgatga 368
|||||||| |||||||| ||||| || |||||||| |||| ||||| || ||||||||
Sbjct: 181 attgctgcaacttttgctaatgcaacatatgagaggttgccacttgatgatgatgatga 239