Miyakogusa Predicted Gene

Lj6g3v0043500.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0043500.1 Non Chatacterized Hit- tr|I1NI15|I1NI15_SOYBN
Uncharacterized protein OS=Glycine max PE=4
SV=1,76.41,0,AF0104/ALDC/Ptd012-like,NULL; seg,NULL; DUF296,Domain of
unknown function DUF296; no
description,NUL,NODE_3697_length_1606_cov_318.390411.path2.1
         (582 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC75749 similar to UniRef100_A1DR81 Cluster: AT-hook DN...   531   e-150
gnl|LJGI|TC68245 similar to UniRef100_A7QMS0 Cluster: Chromosome...   172   2e-42

>gnl|LJGI|TC75749 similar to UniRef100_A1DR81 Cluster: AT-hook DNA-binding protein;
           n=1; Catharanthus roseus|Rep: AT-hook DNA-binding
           protein - Catharanthus roseus (Rosy periwinkle)
           (Madagascar periwinkle), partial (55%)
          Length = 628

 Score =  531 bits (268), Expect = e-150
 Identities = 268/268 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggaggtggccggaggagctgatgttgctgagagcgtggcgcagttcgcgaggcggcgc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361 atggaggtggccggaggagctgatgttgctgagagcgtggcgcagttcgcgaggcggcgc 420

                                                                       
Query: 61  cagcgcggggtttgcgttcttagcgggagtggcgctgtggccaatgttaccctacgtcag 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 cagcgcggggtttgcgttcttagcgggagtggcgctgtggccaatgttaccctacgtcag 480

                                                                       
Query: 121 cctgcggcgccgggagctgtggtggcgcttcatggaaggtttgagatcttgtccttaact 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481 cctgcggcgccgggagctgtggtggcgcttcatggaaggtttgagatcttgtccttaact 540

                                                                       
Query: 181 ggggcttttcttcctggacctgctcctccaggctccacaggactcacagtgtaccttgct 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541 ggggcttttcttcctggacctgctcctccaggctccacaggactcacagtgtaccttgct 600

                                       
Query: 241 ggaggacagggacaggttgtgggaggga 268
           ||||||||||||||||||||||||||||
Sbjct: 601 ggaggacagggacaggttgtgggaggga 628


>gnl|LJGI|TC68245 similar to UniRef100_A7QMS0 Cluster: Chromosome undetermined
           scaffold_127, whole genome shotgun sequence; n=2; Vitis
           vinifera|Rep: Chromosome undetermined scaffold_127,
           whole genome shotgun sequence - Vitis vinifera (Grape),
           partial (42%)
          Length = 808

 Score =  172 bits (87), Expect = 2e-42
 Identities = 201/239 (84%)
 Strand = Plus / Plus

                                                                       
Query: 130 ccgggagctgtggtggcgcttcatggaaggtttgagatcttgtccttaactggggctttt 189
           ||||| ||||| || || || ||||| |||||||||||||| ||| |||||||||| || 
Sbjct: 1   ccgggtgctgttgtagcactccatggtaggtttgagatcttatccctaactggggcgttc 60

                                                                       
Query: 190 cttcctggacctgctcctccaggctccacaggactcacagtgtaccttgctggaggacag 249
           || ||||| |||||||||||||| ||||| || || |||||||| ||| |||||||||||
Sbjct: 61  ctacctggccctgctcctccaggatccactggtctaacagtgtatctttctggaggacag 120

                                                                       
Query: 250 ggacaggttgtgggagggagtgttgttggatctttagttgctgctggacctgtcatggtg 309
           || ||||| |||||||||||||| || || ||| ||||||| || ||||| || ||||| 
Sbjct: 121 ggtcaggtagtgggagggagtgtggtggggtctctagttgcagcaggaccagttatggtc 180

                                                                      
Query: 310 attgctgctacttttgccaatgctacttatgagagactgccccttgaggaggatgatga 368
           |||||||| |||||||| ||||| || ||||||||  |||| ||||| || ||||||||
Sbjct: 181 attgctgcaacttttgctaatgcaacatatgagaggttgccacttgatgatgatgatga 239