Miyakogusa Predicted Gene

Lj6g3v0029990.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0029990.1 tr|Q9AVR0|Q9AVR0_SESRO Phosphate transporter
OS=Sesbania rostrata GN=pt1 PE=2 SV=1,97.06,0.0000000002,
,NODE_82766_length_133_cov_139.045120.path1.1
         (102 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC66010 similar to UniRef100_Q9AVR0 Cluster: Phosphate ...   194   6e-50
gnl|LJGI|TC57143 UniRef100_Q1T6Z7 Cluster: Phosphate transporter...    70   3e-12

>gnl|LJGI|TC66010 similar to UniRef100_Q9AVR0 Cluster: Phosphate transporter; n=1;
            Sesbania rostrata|Rep: Phosphate transporter - Sesbania
            rostrata, complete
          Length = 1861

 Score =  194 bits (98), Expect = 6e-50
 Identities = 101/102 (99%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcttggtgtgatcaacttcgctgggatgttattcaccttattggttccagaatcaaag 60
            ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 1549 atgcttggtgtgatcaacttcactgggatgttattcaccttattggttccagaatcaaag 1608

                                                      
Query: 61   ggaaaatcactagaggaattgactggggagaatgaagatggt 102
            ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1609 ggaaaatcactagaggaattgactggggagaatgaagatggt 1650


>gnl|LJGI|TC57143 UniRef100_Q1T6Z7 Cluster: Phosphate transporter; n=1; Lotus
            japonicus|Rep: Phosphate transporter - Lotus japonicus,
            complete
          Length = 1981

 Score = 69.9 bits (35), Expect = 3e-12
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1    atgcttggtgtgatcaacttcgctgggatgttattcaccttattggttccagaatcaaag 60
            ||||||||||||||||| |||   |||||| |||||||||| ||||| || |||||||||
Sbjct: 1617 atgcttggtgtgatcaatttcttggggatggtattcacctttttggtgccggaatcaaag 1676

                                           
Query: 61   ggaaaatcactagaggaattgactggggaga 91
            || || ||||| || || |||| ||||||||
Sbjct: 1677 gggaagtcactggaagagttgagtggggaga 1707