Miyakogusa Predicted Gene
- Lj6g3v0000160.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj6g3v0000160.1 tr|I1LC39|I1LC39_SOYBN 3-ketoacyl-CoA synthase
OS=Glycine max GN=Gma.53422 PE=3 SV=1,96.6,0,FAMILY NOT NAMED,NULL;
FAE1_CUT1_RppA,FAE1/Type III polyketide synthase-like protein;
Thiolase-like,,NODE_5121_length_449_cov_450.850769.path2.1
(441 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC65141 similar to UniRef100_A7NWY4 Cluster: Chromosome... 632 0.0
gnl|LJGI|TC78922 similar to UniRef100_A9XUG6 Cluster: Beta-ketoa... 194 3e-49
gnl|LJGI|TC82055 homologue to UniRef100_A7NWY4 Cluster: Chromoso... 129 2e-29
gnl|LJGI|AV412738 similar to UniRef100_A7NWY4 Cluster: Chromosom... 107 6e-23
gnl|LJGI|TC60948 similar to UniRef100_Q2HTC9 Cluster: Chalcone a... 82 3e-15
gnl|LJGI|AV426594 similar to UniRef100_A7P5K1 Cluster: Chromosom... 68 5e-11
gnl|LJGI|TC66657 similar to UniRef100_Q8VWP9 Cluster: Fiddlehead... 60 1e-08
gnl|LJGI|TC60566 homologue to UniRef100_A7X6P9 Cluster: Fiddlehe... 60 1e-08
>gnl|LJGI|TC65141 similar to UniRef100_A7NWY4 Cluster: Chromosome chr5 scaffold_2,
whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
Chromosome chr5 scaffold_2, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (40%)
Length = 914
Score = 632 bits (319), Expect = 0.0
Identities = 319/319 (100%)
Strand = Plus / Plus
Query: 1 atgcagaggtctgagcttactggaacttttacagaagaaaacttggcctttcagaagaag 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 596 atgcagaggtctgagcttactggaacttttacagaagaaaacttggcctttcagaagaag 655
Query: 61 attcttgagaggtctggtttggggcagaagacttacttgcctcctgcaatcttgagtatt 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 656 attcttgagaggtctggtttggggcagaagacttacttgcctcctgcaatcttgagtatt 715
Query: 121 ccaccaaacccttgtatggctgaagcaaggaaagaggcagagcaggtgatgtttggtgcc 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 716 ccaccaaacccttgtatggctgaagcaaggaaagaggcagagcaggtgatgtttggtgcc 775
Query: 181 attgatcagcttctggagaaaactggtgtgaaggctaaggatattgggatcttggtggtg 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 776 attgatcagcttctggagaaaactggtgtgaaggctaaggatattgggatcttggtggtg 835
Query: 241 aattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatcactacaag 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 836 aattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatcactacaag 895
Query: 301 ttgagagggaacattcaaa 319
|||||||||||||||||||
Sbjct: 896 ttgagagggaacattcaaa 914
>gnl|LJGI|TC78922 similar to UniRef100_A9XUG6 Cluster: Beta-ketoacyl-CoA synthase;
n=1; Gossypium hirsutum|Rep: Beta-ketoacyl-CoA synthase
- Gossypium hirsutum (Upland cotton) (Gossypium
mexicanum), partial (33%)
Length = 746
Score = 194 bits (98), Expect = 3e-49
Identities = 152/170 (89%)
Strand = Plus / Plus
Query: 49 tttcagaagaagattcttgagaggtctggtttggggcagaagacttacttgcctcctgca 108
|||||||||||||| |||||||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 577 tttcagaagaagatacttgagaggtctgggttggggcaaaagacttatttgccccctgca 636
Query: 109 atcttgagtattccaccaaacccttgtatggctgaagcaaggaaagaggcagagcaggtg 168
|||||||| | |||||| |||| |||||||||||||||||||| || || ||| ||||
Sbjct: 637 atcttgagggtgccaccagacccgtgtatggctgaagcaaggaaggaagcggaggaggtc 696
Query: 169 atgtttggtgccattgatcagcttctggagaaaactggtgtgaaggctaa 218
||||||||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 697 atgtttggtgcaattgatcagcttcttgaaaaaactggtgtgaaggctaa 746
>gnl|LJGI|TC82055 homologue to UniRef100_A7NWY4 Cluster: Chromosome chr5 scaffold_2,
whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
Chromosome chr5 scaffold_2, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (29%)
Length = 465
Score = 129 bits (65), Expect = 2e-29
Identities = 89/97 (91%)
Strand = Plus / Plus
Query: 344 gcagtgctggactaatctctatagaccttgccaaacagctccttcaggttcatcccaact 403
|||||||||| || |||||||||||||||||||| ||||| || ||||| ||||||||||
Sbjct: 2 gcagtgctggcctcatctctatagaccttgccaagcagctactccaggtgcatcccaact 61
Query: 404 cttatgccttagtggtgagcatggagaacatcactct 440
||||||||||||| ||||||||||| |||||||||||
Sbjct: 62 cttatgccttagtagtgagcatggaaaacatcactct 98
>gnl|LJGI|AV412738 similar to UniRef100_A7NWY4 Cluster: Chromosome chr5 scaffold_2,
whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
Chromosome chr5 scaffold_2, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (17%)
Length = 397
Score = 107 bits (54), Expect = 6e-23
Identities = 54/54 (100%)
Strand = Plus / Plus
Query: 388 caggttcatcccaactcttatgccttagtggtgagcatggagaacatcactctc 441
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138 caggttcatcccaactcttatgccttagtggtgagcatggagaacatcactctc 191
>gnl|LJGI|TC60948 similar to UniRef100_Q2HTC9 Cluster: Chalcone and stilbene
synthases, N-terminal; Chalcone and stilbene synthases,
C-terminal; Very-long-chain 3-ketoacyl-CoA synthase;
n=1; Medicago truncatula|Rep: Chalcone and stilbene
synthases, N-terminal; Chalcone and stilbene synthases,
C-terminal; Very-long-chain 3-ketoacyl-CoA synthase -
Medicago truncatula (Barrel medic), partial (47%)
Length = 889
Score = 81.8 bits (41), Expect = 3e-15
Identities = 65/73 (89%)
Strand = Plus / Plus
Query: 233 tggtggtgaattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatc 292
|||||||||||||||||||||||||||| || || || ||||| |||||||||||||| |
Sbjct: 774 tggtggtgaattgcagcttgttcaacccgacgccgtcgctctccgccatgattgtgaacc 833
Query: 293 actacaagttgag 305
| |||||| ||||
Sbjct: 834 attacaagctgag 846
>gnl|LJGI|AV426594 similar to UniRef100_A7P5K1 Cluster: Chromosome chr4 scaffold_6,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr4 scaffold_6, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (27%)
Length = 415
Score = 67.9 bits (34), Expect = 5e-11
Identities = 49/54 (90%)
Strand = Plus / Plus
Query: 385 cttcaggttcatcccaactcttatgccttagtggtgagcatggagaacatcact 438
||||||||||| |||||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 46 cttcaggttcaccccaactcctatgcattggtggttagcatggagaacatcact 99
>gnl|LJGI|TC66657 similar to UniRef100_Q8VWP9 Cluster: Fiddlehead-like protein; n=1;
Gossypium hirsutum|Rep: Fiddlehead-like protein -
Gossypium hirsutum (Upland cotton) (Gossypium
mexicanum), partial (52%)
Length = 968
Score = 60.0 bits (30), Expect = 1e-08
Identities = 96/118 (81%)
Strand = Plus / Plus
Query: 233 tggtggtgaattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatc 292
|||||||||| |||||| | |||||||| || || || || || || ||||| | || |
Sbjct: 772 tggtggtgaactgcagcatcttcaacccaacgccgtcgctttcagcgatgatcataaacc 831
Query: 293 actacaagttgagagggaacattcaaagttataatcttggtggcatgggatgcagtgc 350
|||||||| ||||||||||||||| || || ||||| ||||| ||||| ||||||||
Sbjct: 832 actacaagatgagagggaacattctgagctacaatctgggtggaatggggtgcagtgc 889
>gnl|LJGI|TC60566 homologue to UniRef100_A7X6P9 Cluster: Fiddlehead-like protein;
n=1; Pisum sativum|Rep: Fiddlehead-like protein - Pisum
sativum (Garden pea), partial (84%)
Length = 1273
Score = 60.0 bits (30), Expect = 1e-08
Identities = 96/118 (81%)
Strand = Plus / Plus
Query: 233 tggtggtgaattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatc 292
|||||||||| |||||| | |||||||| || || || || || || ||||| | || |
Sbjct: 71 tggtggtgaactgcagcatcttcaacccaacgccgtcgctttcagcgatgatcataaacc 130
Query: 293 actacaagttgagagggaacattcaaagttataatcttggtggcatgggatgcagtgc 350
|||||||| ||||||||||||||| || || ||||| ||||| ||||| ||||||||
Sbjct: 131 actacaagatgagagggaacattctgagctacaatctgggtggaatggggtgcagtgc 188