Miyakogusa Predicted Gene

Lj6g3v0000160.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj6g3v0000160.1 tr|I1LC39|I1LC39_SOYBN 3-ketoacyl-CoA synthase
OS=Glycine max GN=Gma.53422 PE=3 SV=1,96.6,0,FAMILY NOT NAMED,NULL;
FAE1_CUT1_RppA,FAE1/Type III polyketide synthase-like protein;
Thiolase-like,,NODE_5121_length_449_cov_450.850769.path2.1
         (441 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC65141 similar to UniRef100_A7NWY4 Cluster: Chromosome...   632   0.0  
gnl|LJGI|TC78922 similar to UniRef100_A9XUG6 Cluster: Beta-ketoa...   194   3e-49
gnl|LJGI|TC82055 homologue to UniRef100_A7NWY4 Cluster: Chromoso...   129   2e-29
gnl|LJGI|AV412738 similar to UniRef100_A7NWY4 Cluster: Chromosom...   107   6e-23
gnl|LJGI|TC60948 similar to UniRef100_Q2HTC9 Cluster: Chalcone a...    82   3e-15
gnl|LJGI|AV426594 similar to UniRef100_A7P5K1 Cluster: Chromosom...    68   5e-11
gnl|LJGI|TC66657 similar to UniRef100_Q8VWP9 Cluster: Fiddlehead...    60   1e-08
gnl|LJGI|TC60566 homologue to UniRef100_A7X6P9 Cluster: Fiddlehe...    60   1e-08

>gnl|LJGI|TC65141 similar to UniRef100_A7NWY4 Cluster: Chromosome chr5 scaffold_2,
           whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_2, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (40%)
          Length = 914

 Score =  632 bits (319), Expect = 0.0
 Identities = 319/319 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgcagaggtctgagcttactggaacttttacagaagaaaacttggcctttcagaagaag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 596 atgcagaggtctgagcttactggaacttttacagaagaaaacttggcctttcagaagaag 655

                                                                       
Query: 61  attcttgagaggtctggtttggggcagaagacttacttgcctcctgcaatcttgagtatt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 656 attcttgagaggtctggtttggggcagaagacttacttgcctcctgcaatcttgagtatt 715

                                                                       
Query: 121 ccaccaaacccttgtatggctgaagcaaggaaagaggcagagcaggtgatgtttggtgcc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 716 ccaccaaacccttgtatggctgaagcaaggaaagaggcagagcaggtgatgtttggtgcc 775

                                                                       
Query: 181 attgatcagcttctggagaaaactggtgtgaaggctaaggatattgggatcttggtggtg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 776 attgatcagcttctggagaaaactggtgtgaaggctaaggatattgggatcttggtggtg 835

                                                                       
Query: 241 aattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatcactacaag 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 836 aattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatcactacaag 895

                              
Query: 301 ttgagagggaacattcaaa 319
           |||||||||||||||||||
Sbjct: 896 ttgagagggaacattcaaa 914


>gnl|LJGI|TC78922 similar to UniRef100_A9XUG6 Cluster: Beta-ketoacyl-CoA synthase;
           n=1; Gossypium hirsutum|Rep: Beta-ketoacyl-CoA synthase
           - Gossypium hirsutum (Upland cotton) (Gossypium
           mexicanum), partial (33%)
          Length = 746

 Score =  194 bits (98), Expect = 3e-49
 Identities = 152/170 (89%)
 Strand = Plus / Plus

                                                                       
Query: 49  tttcagaagaagattcttgagaggtctggtttggggcagaagacttacttgcctcctgca 108
           |||||||||||||| |||||||||||||| |||||||| |||||||| ||||| ||||||
Sbjct: 577 tttcagaagaagatacttgagaggtctgggttggggcaaaagacttatttgccccctgca 636

                                                                       
Query: 109 atcttgagtattccaccaaacccttgtatggctgaagcaaggaaagaggcagagcaggtg 168
           ||||||||  | |||||| |||| |||||||||||||||||||| || || ||| |||| 
Sbjct: 637 atcttgagggtgccaccagacccgtgtatggctgaagcaaggaaggaagcggaggaggtc 696

                                                             
Query: 169 atgtttggtgccattgatcagcttctggagaaaactggtgtgaaggctaa 218
           ||||||||||| |||||||||||||| || ||||||||||||||||||||
Sbjct: 697 atgtttggtgcaattgatcagcttcttgaaaaaactggtgtgaaggctaa 746


>gnl|LJGI|TC82055 homologue to UniRef100_A7NWY4 Cluster: Chromosome chr5 scaffold_2,
           whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_2, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (29%)
          Length = 465

 Score =  129 bits (65), Expect = 2e-29
 Identities = 89/97 (91%)
 Strand = Plus / Plus

                                                                       
Query: 344 gcagtgctggactaatctctatagaccttgccaaacagctccttcaggttcatcccaact 403
           |||||||||| || |||||||||||||||||||| ||||| || ||||| ||||||||||
Sbjct: 2   gcagtgctggcctcatctctatagaccttgccaagcagctactccaggtgcatcccaact 61

                                                
Query: 404 cttatgccttagtggtgagcatggagaacatcactct 440
           ||||||||||||| ||||||||||| |||||||||||
Sbjct: 62  cttatgccttagtagtgagcatggaaaacatcactct 98


>gnl|LJGI|AV412738 similar to UniRef100_A7NWY4 Cluster: Chromosome chr5 scaffold_2,
           whole genome shotgun sequence; n=2; Vitis vinifera|Rep:
           Chromosome chr5 scaffold_2, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (17%)
          Length = 397

 Score =  107 bits (54), Expect = 6e-23
 Identities = 54/54 (100%)
 Strand = Plus / Plus

                                                                 
Query: 388 caggttcatcccaactcttatgccttagtggtgagcatggagaacatcactctc 441
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 138 caggttcatcccaactcttatgccttagtggtgagcatggagaacatcactctc 191


>gnl|LJGI|TC60948 similar to UniRef100_Q2HTC9 Cluster: Chalcone and stilbene
           synthases, N-terminal; Chalcone and stilbene synthases,
           C-terminal; Very-long-chain 3-ketoacyl-CoA synthase;
           n=1; Medicago truncatula|Rep: Chalcone and stilbene
           synthases, N-terminal; Chalcone and stilbene synthases,
           C-terminal; Very-long-chain 3-ketoacyl-CoA synthase -
           Medicago truncatula (Barrel medic), partial (47%)
          Length = 889

 Score = 81.8 bits (41), Expect = 3e-15
 Identities = 65/73 (89%)
 Strand = Plus / Plus

                                                                       
Query: 233 tggtggtgaattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatc 292
           |||||||||||||||||||||||||||| || || || ||||| |||||||||||||| |
Sbjct: 774 tggtggtgaattgcagcttgttcaacccgacgccgtcgctctccgccatgattgtgaacc 833

                        
Query: 293 actacaagttgag 305
           | |||||| ||||
Sbjct: 834 attacaagctgag 846


>gnl|LJGI|AV426594 similar to UniRef100_A7P5K1 Cluster: Chromosome chr4 scaffold_6,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr4 scaffold_6, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (27%)
          Length = 415

 Score = 67.9 bits (34), Expect = 5e-11
 Identities = 49/54 (90%)
 Strand = Plus / Plus

                                                                 
Query: 385 cttcaggttcatcccaactcttatgccttagtggtgagcatggagaacatcact 438
           ||||||||||| |||||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 46  cttcaggttcaccccaactcctatgcattggtggttagcatggagaacatcact 99


>gnl|LJGI|TC66657 similar to UniRef100_Q8VWP9 Cluster: Fiddlehead-like protein; n=1;
           Gossypium hirsutum|Rep: Fiddlehead-like protein -
           Gossypium hirsutum (Upland cotton) (Gossypium
           mexicanum), partial (52%)
          Length = 968

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 233 tggtggtgaattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatc 292
           |||||||||| |||||| | |||||||| || || || || || || |||||  | || |
Sbjct: 772 tggtggtgaactgcagcatcttcaacccaacgccgtcgctttcagcgatgatcataaacc 831

                                                                     
Query: 293 actacaagttgagagggaacattcaaagttataatcttggtggcatgggatgcagtgc 350
           |||||||| |||||||||||||||  || || ||||| ||||| ||||| ||||||||
Sbjct: 832 actacaagatgagagggaacattctgagctacaatctgggtggaatggggtgcagtgc 889


>gnl|LJGI|TC60566 homologue to UniRef100_A7X6P9 Cluster: Fiddlehead-like protein;
           n=1; Pisum sativum|Rep: Fiddlehead-like protein - Pisum
           sativum (Garden pea), partial (84%)
          Length = 1273

 Score = 60.0 bits (30), Expect = 1e-08
 Identities = 96/118 (81%)
 Strand = Plus / Plus

                                                                       
Query: 233 tggtggtgaattgcagcttgttcaaccctacaccatctctctctgccatgattgtgaatc 292
           |||||||||| |||||| | |||||||| || || || || || || |||||  | || |
Sbjct: 71  tggtggtgaactgcagcatcttcaacccaacgccgtcgctttcagcgatgatcataaacc 130

                                                                     
Query: 293 actacaagttgagagggaacattcaaagttataatcttggtggcatgggatgcagtgc 350
           |||||||| |||||||||||||||  || || ||||| ||||| ||||| ||||||||
Sbjct: 131 actacaagatgagagggaacattctgagctacaatctgggtggaatggggtgcagtgc 188