Miyakogusa Predicted Gene

Lj5g3v2300410.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2300410.1 CUFF.57321.1
         (945 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC74675 weakly similar to UniRef100_A2Q2S7 Cluster: Gen...    52   6e-06

>gnl|LJGI|TC74675 weakly similar to UniRef100_A2Q2S7 Cluster: General substrate
           transporter; n=1; Medicago truncatula|Rep: General
           substrate transporter - Medicago truncatula (Barrel
           medic), partial (20%)
          Length = 500

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                       
Query: 682 gtgccatggactgtgaactcagagatataccctgaagagtacagaggaatttgtggtggc 741
           ||||||||||||||||||||||| || || || ||||| | | ||||  | ||||| |||
Sbjct: 4   gtgccatggactgtgaactcagaaatctatccagaagaattccgaggtgtatgtgggggc 63

                         
Query: 742 atgtcagctactgt 755
           |||||||| |||||
Sbjct: 64  atgtcagccactgt 77