Miyakogusa Predicted Gene
- Lj5g3v2295700.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2295700.1 tr|G7KWP5|G7KWP5_MEDTR Callose synthase
OS=Medicago truncatula GN=MTR_7g005950 PE=4 SV=1,91.22,0,seg,NULL;
Glucan_synthase,Glycosyl transferase, family 48; SUBFAMILY NOT
NAMED,Callose synthase; LYS,CUFF.57289.1
(1134 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC81942 homologue to UniRef100_A2Q2S3 Cluster: Glycosyl... 498 e-140
gnl|LJGI|TC74803 homologue to UniRef100_Q9AUE0 Cluster: Callose ... 333 1e-90
gnl|LJGI|BP057687 similar to UniRef100_A7P002 Cluster: Chromosom... 98 1e-19
>gnl|LJGI|TC81942 homologue to UniRef100_A2Q2S3 Cluster: Glycosyl transferase, family
48; n=1; Medicago truncatula|Rep: Glycosyl transferase,
family 48 - Medicago truncatula (Barrel medic), partial
(14%)
Length = 538
Score = 498 bits (251), Expect = e-140
Identities = 450/522 (86%)
Strand = Plus / Plus
Query: 468 aggtgtaccatctgaaaaaagttgggaatcctggtgggaagaggaacaagagcatctcca 527
|||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 15 aggtgtaccacctgaaaaaagttgggaatcttggtgggaagaggaacaagatcatctcca 74
Query: 528 atattcaggaatgcgcggaatcatagctgagatattgttatctttgcggttttttatcta 587
||||||||| |||| ||||||||| |||||||||||||| ||||| || ||||||||
Sbjct: 75 ctattcaggattgcgtggaatcatactggagatattgttatcattgcgattctttatcta 134
Query: 588 tcagtatggtcttgtttatcacttgaactttacgnnnnnnnnnnnnnnnngttttctgat 647
|||||||||||||| ||||||||||| ||||| |||||||| |
Sbjct: 135 ccagtatggtcttgtatatcacttgaaatttacaaagaagggcgacaaaagttttctggt 194
Query: 648 ctatggcatatcatggttggtgatctttctaatactatttgtaatgaagacggtgtctgt 707
|||||||| || ||||||||||||||| ||||| | ||||| ||||| || ||||| ||
Sbjct: 195 atatggcatttcgtggttggtgatctttgtaatattgtttgtgatgaanactgtgtccgt 254
Query: 708 tgggagacgaaaattcagtgcagattttcaacttgtcttccggttaatcaagggaatgat 767
|||||| || |||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 255 tgggaggcggaaattcagtgcaaattttcaacttgtcttccggctaatcaagggaatgat 314
Query: 768 attcgtggcttttgtctcgattctagtcaccatgattgcccttcctcacatgacaatgca 827
|||| | |||||||||| ||||| || || ||||||||||||| || |||||| ||||
Sbjct: 315 attcctaacttttgtctctattcttgttactttgattgcccttccacatatgacattgca 374
Query: 828 ggacataattgtttgcattcttgcgttcatgcctactggttgggggatgctacagattgc 887
|||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 375 ggacattgttgtttgcattcttgcgttcatgccaactggttggggaatgctacagattgc 434
Query: 888 acaagcattaaagcctctagtacgccgagctggattttggggatcagtaaaaactctggc 947
||||||||||| || || |||||||| ||||||||||||||||||||||||||||| ||
Sbjct: 435 tcaagcattaaaaccccttgtacgccgtgctggattttggggatcagtaaaaactcttgc 494
Query: 948 ccgtggttatgaggttgtgatgggtttgcttttgttcactcc 989
|| || |||||| ||||||||||||||||||||||||||||
Sbjct: 495 tcgcggatatgagattgtgatgggtttgcttttgttcactcc 536
>gnl|LJGI|TC74803 homologue to UniRef100_Q9AUE0 Cluster: Callose synthase 1 catalytic
subunit; n=1; Arabidopsis thaliana|Rep: Callose synthase
1 catalytic subunit - Arabidopsis thaliana (Mouse-ear
cress), partial (3%)
Length = 499
Score = 333 bits (168), Expect = 1e-90
Identities = 176/179 (98%)
Strand = Plus / Plus
Query: 956 atgaggttgtgatgggtttgcttttgttcactccagttgccttcctggcttggtttcctt 1015
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 atgagtttgtgatggntttgcttttgttcactccagttgccttcctggcttggtttcctt 60
Query: 1016 ttgtttcagaatttcagacccgcatgctgttcaaccaagctttcagccgaggtttgcaaa 1075
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 ttgtttcagaatttcagacccgcatgctgttcaaccaagctttcagccgaggtttgcaaa 120
Query: 1076 tttctcgtatccttggaggccaaaggaagggacgctcttctcgcaacaaggaatagttt 1134
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 121 tttctcgtatccttggaggccaaaggaagggacgctcttctcacaacaaggaatagttt 179
>gnl|LJGI|BP057687 similar to UniRef100_A7P002 Cluster: Chromosome chr6 scaffold_3,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr6 scaffold_3, whole genome shotgun sequence
- Vitis vinifera (Grape), partial (29%)
Length = 573
Score = 97.6 bits (49), Expect = 1e-19
Identities = 106/125 (84%)
Strand = Plus / Minus
Query: 967 atgggtttgcttttgttcactccagttgccttcctggcttggtttccttttgtttcagaa 1026
||||| |||||| | ||||| ||| |||| ||| |||| ||||| || ||||||||||||
Sbjct: 389 atgggcttgcttctcttcacaccaattgctttcttggcatggttcccatttgtttcagaa 330
Query: 1027 tttcagacccgcatgctgttcaaccaagctttcagccgaggtttgcaaatttctcgtatc 1086
||||| || | ||||| ||||||||||||||||| |||||||||| |||||||||||
Sbjct: 329 tttcaaacaagaatgcttttcaaccaagctttcagtagaggtttgcagatttctcgtatt 270
Query: 1087 cttgg 1091
|||||
Sbjct: 269 cttgg 265