Miyakogusa Predicted Gene

Lj5g3v2295700.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2295700.1 tr|G7KWP5|G7KWP5_MEDTR Callose synthase
OS=Medicago truncatula GN=MTR_7g005950 PE=4 SV=1,91.22,0,seg,NULL;
Glucan_synthase,Glycosyl transferase, family 48; SUBFAMILY NOT
NAMED,Callose synthase; LYS,CUFF.57289.1
         (1134 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC81942 homologue to UniRef100_A2Q2S3 Cluster: Glycosyl...   498   e-140
gnl|LJGI|TC74803 homologue to UniRef100_Q9AUE0 Cluster: Callose ...   333   1e-90
gnl|LJGI|BP057687 similar to UniRef100_A7P002 Cluster: Chromosom...    98   1e-19

>gnl|LJGI|TC81942 homologue to UniRef100_A2Q2S3 Cluster: Glycosyl transferase, family
           48; n=1; Medicago truncatula|Rep: Glycosyl transferase,
           family 48 - Medicago truncatula (Barrel medic), partial
           (14%)
          Length = 538

 Score =  498 bits (251), Expect = e-140
 Identities = 450/522 (86%)
 Strand = Plus / Plus

                                                                       
Query: 468 aggtgtaccatctgaaaaaagttgggaatcctggtgggaagaggaacaagagcatctcca 527
           |||||||||| ||||||||||||||||||| |||||||||||||||||||| ||||||||
Sbjct: 15  aggtgtaccacctgaaaaaagttgggaatcttggtgggaagaggaacaagatcatctcca 74

                                                                       
Query: 528 atattcaggaatgcgcggaatcatagctgagatattgttatctttgcggttttttatcta 587
            ||||||||| |||| |||||||||   |||||||||||||| ||||| || ||||||||
Sbjct: 75  ctattcaggattgcgtggaatcatactggagatattgttatcattgcgattctttatcta 134

                                                                       
Query: 588 tcagtatggtcttgtttatcacttgaactttacgnnnnnnnnnnnnnnnngttttctgat 647
            |||||||||||||| ||||||||||| |||||                 |||||||| |
Sbjct: 135 ccagtatggtcttgtatatcacttgaaatttacaaagaagggcgacaaaagttttctggt 194

                                                                       
Query: 648 ctatggcatatcatggttggtgatctttctaatactatttgtaatgaagacggtgtctgt 707
            |||||||| || ||||||||||||||| ||||| | ||||| ||||| || ||||| ||
Sbjct: 195 atatggcatttcgtggttggtgatctttgtaatattgtttgtgatgaanactgtgtccgt 254

                                                                       
Query: 708 tgggagacgaaaattcagtgcagattttcaacttgtcttccggttaatcaagggaatgat 767
           |||||| || |||||||||||| |||||||||||||||||||| ||||||||||||||||
Sbjct: 255 tgggaggcggaaattcagtgcaaattttcaacttgtcttccggctaatcaagggaatgat 314

                                                                       
Query: 768 attcgtggcttttgtctcgattctagtcaccatgattgcccttcctcacatgacaatgca 827
           |||| |  |||||||||| ||||| || ||  ||||||||||||| || |||||| ||||
Sbjct: 315 attcctaacttttgtctctattcttgttactttgattgcccttccacatatgacattgca 374

                                                                       
Query: 828 ggacataattgtttgcattcttgcgttcatgcctactggttgggggatgctacagattgc 887
           ||||||  ||||||||||||||||||||||||| ||||||||||| ||||||||||||||
Sbjct: 375 ggacattgttgtttgcattcttgcgttcatgccaactggttggggaatgctacagattgc 434

                                                                       
Query: 888 acaagcattaaagcctctagtacgccgagctggattttggggatcagtaaaaactctggc 947
            ||||||||||| || || |||||||| ||||||||||||||||||||||||||||| ||
Sbjct: 435 tcaagcattaaaaccccttgtacgccgtgctggattttggggatcagtaaaaactcttgc 494

                                                     
Query: 948 ccgtggttatgaggttgtgatgggtttgcttttgttcactcc 989
            || || |||||| ||||||||||||||||||||||||||||
Sbjct: 495 tcgcggatatgagattgtgatgggtttgcttttgttcactcc 536


>gnl|LJGI|TC74803 homologue to UniRef100_Q9AUE0 Cluster: Callose synthase 1 catalytic
            subunit; n=1; Arabidopsis thaliana|Rep: Callose synthase
            1 catalytic subunit - Arabidopsis thaliana (Mouse-ear
            cress), partial (3%)
          Length = 499

 Score =  333 bits (168), Expect = 1e-90
 Identities = 176/179 (98%)
 Strand = Plus / Plus

                                                                        
Query: 956  atgaggttgtgatgggtttgcttttgttcactccagttgccttcctggcttggtttcctt 1015
            ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    atgagtttgtgatggntttgcttttgttcactccagttgccttcctggcttggtttcctt 60

                                                                        
Query: 1016 ttgtttcagaatttcagacccgcatgctgttcaaccaagctttcagccgaggtttgcaaa 1075
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   ttgtttcagaatttcagacccgcatgctgttcaaccaagctttcagccgaggtttgcaaa 120

                                                                       
Query: 1076 tttctcgtatccttggaggccaaaggaagggacgctcttctcgcaacaaggaatagttt 1134
            |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 121  tttctcgtatccttggaggccaaaggaagggacgctcttctcacaacaaggaatagttt 179


>gnl|LJGI|BP057687 similar to UniRef100_A7P002 Cluster: Chromosome chr6 scaffold_3,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr6 scaffold_3, whole genome shotgun sequence
            - Vitis vinifera (Grape), partial (29%)
          Length = 573

 Score = 97.6 bits (49), Expect = 1e-19
 Identities = 106/125 (84%)
 Strand = Plus / Minus

                                                                        
Query: 967  atgggtttgcttttgttcactccagttgccttcctggcttggtttccttttgtttcagaa 1026
            ||||| |||||| | ||||| ||| |||| ||| |||| ||||| || ||||||||||||
Sbjct: 389  atgggcttgcttctcttcacaccaattgctttcttggcatggttcccatttgtttcagaa 330

                                                                        
Query: 1027 tttcagacccgcatgctgttcaaccaagctttcagccgaggtttgcaaatttctcgtatc 1086
            ||||| ||  | ||||| |||||||||||||||||  |||||||||| ||||||||||| 
Sbjct: 329  tttcaaacaagaatgcttttcaaccaagctttcagtagaggtttgcagatttctcgtatt 270

                 
Query: 1087 cttgg 1091
            |||||
Sbjct: 269  cttgg 265