Miyakogusa Predicted Gene
- Lj5g3v2295690.4
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2295690.4 tr|G7IAY2|G7IAY2_MEDTR Callose synthase
OS=Medicago truncatula GN=MTR_1g116370 PE=4
SV=1,91.47,0,Glucan_synthase,Glycosyl transferase, family 48;
seg,NULL; SUBFAMILY NOT NAMED,Callose synthase; LYS,CUFF.57288.4
(2109 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP052274 homologue to UniRef100_A2Q2S3 Cluster: Glycosy... 307 2e-82
>gnl|LJGI|BP052274 homologue to UniRef100_A2Q2S3 Cluster: Glycosyl transferase, family
48; n=1; Medicago truncatula|Rep: Glycosyl transferase,
family 48 - Medicago truncatula (Barrel medic), partial
(15%)
Length = 563
Score = 307 bits (155), Expect = 2e-82
Identities = 274/311 (88%), Gaps = 2/311 (0%)
Strand = Plus / Plus
Query: 1801 aagaagcatgacggtgtgagattccccagtattcttggacttagggagcatatattcac- 1859
||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||
Sbjct: 1 aagaagcatgatggggtgaggttcccaagtattcttggacttagggagcatatatttacn 60
Query: 1860 tggaagtgtttcttctcttg-catggtttatgtctaatcaagagacaagttttgtgacaa 1918
||||||||||||||| || | ||||||| ||||| ||||| ||||||||||| |||||||
Sbjct: 61 tggaagtgtttcttcgctgggcatggttcatgtcaaatcaggagacaagtttcgtgacaa 120
Query: 1919 ttggtcagagattgttggctaatccactgagagttcgcttccactatggtcaccctgatg 1978
||||||| ||||||||||||||||| |||| ||||| |||||||||||||| || ||||
Sbjct: 121 ttggtcaaagattgttggctaatcccctgaaggttcgtttccactatggtcatcccgatg 180
Query: 1979 tttttgatcggctttttcacctcacaagagggggtgtcagcaaagcctccaaggttataa 2038
| || ||| ||||||||||||| ||||||||||||||||| ||||||| ||||||| |
Sbjct: 181 tcttcgataggctttttcacctgacaagagggggtgtcagtaaagcctgggaggttatca 240
Query: 2039 acttgagcgaagatatctttgctggcttcaactctacacttcgtgaaggaaatgttactc 2098
| | || |||||||| ||||||||||||||||||||||| || |||||||||||||| |
Sbjct: 241 atctaagtgaagatatttttgctggcttcaactctacactccgggaaggaaatgttaccc 300
Query: 2099 atcatgagtac 2109
|||||||||||
Sbjct: 301 atcatgagtac 311