Miyakogusa Predicted Gene

Lj5g3v2291280.1

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2291280.1 tr|G7IF28|G7IF28_MEDTR Transketolase OS=Medicago
truncatula GN=MTR_1g116120 PE=4 SV=1,95.92,0,no description,NULL;
TRANSKETOLASE,NULL; DEHYDROGENASE RELATED,NULL; Thiamin
diphosphate-binding fol,NODE_7223_length_329_cov_2982.668701.path1.1
         (294 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC76358                                                      490   e-138
gnl|LJGI|TC67775 similar to UniRef100_Q8LE99 Cluster: Transketol...   218   1e-56

>gnl|LJGI|TC76358 
          Length = 657

 Score =  490 bits (247), Expect = e-138
 Identities = 247/247 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggttgtgctccgatgggtcatattctctatgatgagatcatgaggtacaatcctaag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411 atgggttgtgctccgatgggtcatattctctatgatgagatcatgaggtacaatcctaag 470

                                                                       
Query: 61  aacccttcttggttcaaccgtgacaggtttgttctctctgctggccatggatgcatgctc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471 aacccttcttggttcaaccgtgacaggtttgttctctctgctggccatggatgcatgctc 530

                                                                       
Query: 121 cagtatgctctgcttcaccttgctggatatgacagtgtcaaggaagaggacttgaaggaa 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 531 cagtatgctctgcttcaccttgctggatatgacagtgtcaaggaagaggacttgaaggaa 590

                                                                       
Query: 181 ttccgtcagtggggaagcaaaactcctgggcatcctgagaattttgagacatatggaatt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591 ttccgtcagtggggaagcaaaactcctgggcatcctgagaattttgagacatatggaatt 650

                  
Query: 241 gaagtga 247
           |||||||
Sbjct: 651 gaagtga 657


>gnl|LJGI|TC67775 similar to UniRef100_Q8LE99 Cluster: Transketolase-like protein;
           n=1; Arabidopsis thaliana|Rep: Transketolase-like
           protein - Arabidopsis thaliana (Mouse-ear cress),
           partial (27%)
          Length = 806

 Score =  218 bits (110), Expect = 1e-56
 Identities = 236/278 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1   atgggttgtgctccgatgggtcatattctctatgatgagatcatgaggtacaatcctaag 60
           |||||||| ||||||||||||||  | ||||| |||||||||||||||||||| || || 
Sbjct: 378 atgggttgcgctccgatgggtcacgtgctctacgatgagatcatgaggtacaaccccaaa 437

                                                                       
Query: 61  aacccttcttggttcaaccgtgacaggtttgttctctctgctggccatggatgcatgctc 120
           |||||    ||||||||||| ||  |||| ||||| ||||| || ||||| |||||||||
Sbjct: 438 aaccccaagtggttcaaccgcgatcggttcgttctgtctgcgggtcatggttgcatgctc 497

                                                                       
Query: 121 cagtatgctctgcttcaccttgctggatatgacagtgtcaaggaagaggacttgaaggaa 180
           || ||||||||||||||||||||||| |  ||||| || |||||||| || |||||||||
Sbjct: 498 cactatgctctgcttcaccttgctggcttcgacagcgttaaggaagaagatttgaaggaa 557

                                                                       
Query: 181 ttccgtcagtggggaagcaaaactcctgggcatcctgagaattttgagacatatggaatt 240
           ||||| || ||||| |||| |||||| || ||||||||||| ||||||||   |||||||
Sbjct: 558 ttccggcaatgggggagcagaactccgggacatcctgagaactttgagacccctggaatt 617

                                                 
Query: 241 gaagtgaccacaggtcctctgggtcagggcattgccaa 278
           ||||| || ||||||||||| |||||||| ||||||||
Sbjct: 618 gaagtcacaacaggtcctcttggtcaggggattgccaa 655