Miyakogusa Predicted Gene
- Lj5g3v2288460.1
 
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2288460.1 Non Chatacterized Hit- tr|I1NJ54|I1NJ54_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51474 PE,90.26,0,P-loop
containing nucleoside triphosphate hydrolases,NULL; ABC transporter
transmembrane region,ABC ,CUFF.57173.1
         (3729 letters)
Database: LJGI 
           47,486 sequences; 32,788,469 total letters
Searching..................................................done
                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gnl|LJGI|TC81398 homologue to UniRef100_A7PJ09 Cluster: Chromoso...    84   7e-15
>gnl|LJGI|TC81398 homologue to UniRef100_A7PJ09 Cluster: Chromosome chr13 scaffold_17,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr13 scaffold_17, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (13%)
          Length = 1055
 Score = 83.8 bits (42), Expect = 7e-15
 Identities = 42/42 (100%)
 Strand = Plus / Plus
                                                      
Query: 3688 tgtaagggaaaatatcatatatgccagacatactgccagtga 3729
            ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56   tgtaagggaaaatatcatatatgccagacatactgccagtga 97
 Score = 56.0 bits (28), Expect = 2e-06
 Identities = 28/28 (100%)
 Strand = Plus / Plus
                                        
Query: 3656 ggttgagaagccaccttggtctggttca 3683
            ||||||||||||||||||||||||||||
Sbjct: 1    ggttgagaagccaccttggtctggttca 28