Miyakogusa Predicted Gene
- Lj5g3v2288460.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2288460.1 Non Chatacterized Hit- tr|I1NJ54|I1NJ54_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.51474 PE,90.26,0,P-loop
containing nucleoside triphosphate hydrolases,NULL; ABC transporter
transmembrane region,ABC ,CUFF.57173.1
(3729 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC81398 homologue to UniRef100_A7PJ09 Cluster: Chromoso... 84 7e-15
>gnl|LJGI|TC81398 homologue to UniRef100_A7PJ09 Cluster: Chromosome chr13 scaffold_17,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr13 scaffold_17, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (13%)
Length = 1055
Score = 83.8 bits (42), Expect = 7e-15
Identities = 42/42 (100%)
Strand = Plus / Plus
Query: 3688 tgtaagggaaaatatcatatatgccagacatactgccagtga 3729
||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56 tgtaagggaaaatatcatatatgccagacatactgccagtga 97
Score = 56.0 bits (28), Expect = 2e-06
Identities = 28/28 (100%)
Strand = Plus / Plus
Query: 3656 ggttgagaagccaccttggtctggttca 3683
||||||||||||||||||||||||||||
Sbjct: 1 ggttgagaagccaccttggtctggttca 28