Miyakogusa Predicted Gene

Lj5g3v2263960.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2263960.1 Non Chatacterized Hit- tr|I1LFB8|I1LFB8_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.10768
PE,81.21,0,seg,NULL; FAMILY NOT NAMED,NULL; DUF639,Protein of unknown
function DUF639,CUFF.57157.1
         (1044 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|GO016292 similar to UniRef100_Q6BXW0 Cluster: Debaryomy...    64   2e-09
gnl|LJGI|TC80526                                                       64   2e-09
gnl|LJGI|TC69064 similar to UniRef100_A9T9J7 Cluster: Predicted ...    64   2e-09

>gnl|LJGI|GO016292 similar to UniRef100_Q6BXW0 Cluster: Debaryomyces hansenii
           chromosome A of strain CBS767 of Debaryomyces hansenii;
           n=1; Debaryomyces hansenii|Rep: Debaryomyces hansenii
           chromosome A of strain CBS767 of Debaryomyces hansenii -
           Debaryomyces hansenii (Yeast) (Torulaspora hansenii),
           partial (11%)
          Length = 810

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                           
Query: 634 tttgatgcactcaccagttcctctgggcggcg 665
           ||||||||||||||||||||||||||||||||
Sbjct: 32  tttgatgcactcaccagttcctctgggcggcg 1


>gnl|LJGI|TC80526 
          Length = 980

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                           
Query: 634 tttgatgcactcaccagttcctctgggcggcg 665
           ||||||||||||||||||||||||||||||||
Sbjct: 820 tttgatgcactcaccagttcctctgggcggcg 851


>gnl|LJGI|TC69064 similar to UniRef100_A9T9J7 Cluster: Predicted protein; n=1;
           Physcomitrella patens subsp. patens|Rep: Predicted
           protein - Physcomitrella patens subsp. patens, partial
           (23%)
          Length = 804

 Score = 63.9 bits (32), Expect = 2e-09
 Identities = 32/32 (100%)
 Strand = Plus / Plus

                                           
Query: 634 tttgatgcactcaccagttcctctgggcggcg 665
           ||||||||||||||||||||||||||||||||
Sbjct: 584 tttgatgcactcaccagttcctctgggcggcg 615