Miyakogusa Predicted Gene
- Lj5g3v2241020.1
 
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2241020.1 Non Chatacterized Hit- tr|E9C6G1|E9C6G1_CAPO3
Putative uncharacterized protein OS=Capsaspora
owczarz,30.65,1e-17,Possible plasma membrane-binding motif in ju,MORN
motif; no description,Tubulin/FtsZ, GTPase domain;,CUFF.57012.1
         (2313 letters)
Database: LJGI 
           47,486 sequences; 32,788,469 total letters
Searching..................................................done
                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value
gnl|LJGI|BP055186 similar to UniRef100_Q9SSG9 Cluster: F25A4.3; ...   607   e-172
>gnl|LJGI|BP055186 similar to UniRef100_Q9SSG9 Cluster: F25A4.3; n=1; Arabidopsis
            thaliana|Rep: F25A4.3 - Arabidopsis thaliana (Mouse-ear
            cress), partial (14%)
          Length = 515
 Score =  607 bits (306), Expect = e-172
 Identities = 306/306 (100%)
 Strand = Plus / Minus
                                                                        
Query: 2008 aagagatcaggcctcggtactttctatttcaaaaacggagatatgtttcaaggatcatgg 2067
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 515  aagagatcaggcctcggtactttctatttcaaaaacggagatatgtttcaaggatcatgg 456
                                                                        
Query: 2068 agggatgatgtcatgcacggcaagggttggttttattttcacaccagtgatcggtggttt 2127
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455  agggatgatgtcatgcacggcaagggttggttttattttcacaccagtgatcggtggttt 396
                                                                        
Query: 2128 gcgaacttttggaaaggaaaggctaatggtgaagggcggttctacacaaagtctggtgat 2187
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395  gcgaacttttggaaaggaaaggctaatggtgaagggcggttctacacaaagtctggtgat 336
                                                                        
Query: 2188 gcctactttgggaatttcaaagatggatggcggcatggccagtttctttgtattaatgct 2247
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335  gcctactttgggaatttcaaagatggatggcggcatggccagtttctttgtattaatgct 276
                                                                        
Query: 2248 gatgggacaaggtacactgaaatttgggaacatggtgttcttttagacagcaagcagttt 2307
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275  gatgggacaaggtacactgaaatttgggaacatggtgttcttttagacagcaagcagttt 216
                  
Query: 2308 gaggga 2313
            ||||||
Sbjct: 215  gaggga 210