Miyakogusa Predicted Gene
- Lj5g3v2241020.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2241020.1 Non Chatacterized Hit- tr|E9C6G1|E9C6G1_CAPO3
Putative uncharacterized protein OS=Capsaspora
owczarz,30.65,1e-17,Possible plasma membrane-binding motif in ju,MORN
motif; no description,Tubulin/FtsZ, GTPase domain;,CUFF.57012.1
(2313 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|BP055186 similar to UniRef100_Q9SSG9 Cluster: F25A4.3; ... 607 e-172
>gnl|LJGI|BP055186 similar to UniRef100_Q9SSG9 Cluster: F25A4.3; n=1; Arabidopsis
thaliana|Rep: F25A4.3 - Arabidopsis thaliana (Mouse-ear
cress), partial (14%)
Length = 515
Score = 607 bits (306), Expect = e-172
Identities = 306/306 (100%)
Strand = Plus / Minus
Query: 2008 aagagatcaggcctcggtactttctatttcaaaaacggagatatgtttcaaggatcatgg 2067
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 515 aagagatcaggcctcggtactttctatttcaaaaacggagatatgtttcaaggatcatgg 456
Query: 2068 agggatgatgtcatgcacggcaagggttggttttattttcacaccagtgatcggtggttt 2127
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 455 agggatgatgtcatgcacggcaagggttggttttattttcacaccagtgatcggtggttt 396
Query: 2128 gcgaacttttggaaaggaaaggctaatggtgaagggcggttctacacaaagtctggtgat 2187
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 gcgaacttttggaaaggaaaggctaatggtgaagggcggttctacacaaagtctggtgat 336
Query: 2188 gcctactttgggaatttcaaagatggatggcggcatggccagtttctttgtattaatgct 2247
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 335 gcctactttgggaatttcaaagatggatggcggcatggccagtttctttgtattaatgct 276
Query: 2248 gatgggacaaggtacactgaaatttgggaacatggtgttcttttagacagcaagcagttt 2307
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 gatgggacaaggtacactgaaatttgggaacatggtgttcttttagacagcaagcagttt 216
Query: 2308 gaggga 2313
||||||
Sbjct: 215 gaggga 210