Miyakogusa Predicted Gene
- Lj5g3v2240930.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2240930.1 tr|C7S8D2|C7S8D2_SOYBN Germin-like protein 18
OS=Glycine max PE=2 SV=1,91.19,0,GERMIN,Germin, manganese binding
site; Cupin_1,Cupin 1; seg,NULL; GERMIN,Germin; no
description,RmlC,CUFF.57022.1
(629 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59954 similar to UniRef100_A7PPE9 Cluster: Chromosome... 74 1e-12
>gnl|LJGI|TC59954 similar to UniRef100_A7PPE9 Cluster: Chromosome chr8 scaffold_23,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr8 scaffold_23, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (91%)
Length = 901
Score = 73.8 bits (37), Expect = 1e-12
Identities = 58/65 (89%)
Strand = Plus / Plus
Query: 412 gaggtcatggtgtttccaagagggcttgtgcactttcagatgaatgttggagatgggcct 471
||||| ||||||||||| ||||||||| |||| |||| |||||||||||| |||| ||||
Sbjct: 492 gaggttatggtgtttcccagagggcttatgcattttctgatgaatgttggtgatgagcct 551
Query: 472 gcaac 476
|||||
Sbjct: 552 gcaac 556