Miyakogusa Predicted Gene
- Lj5g3v2238670.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2238670.1 Non Chatacterized Hit- tr|I1K7N8|I1K7N8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,68.29,0,FAD_binding_4,FAD linked oxidase, N-terminal; seg,NULL;
PREDICTED: SIMILAR TO L-GULONO-GAMMA-LACTONE,CUFF.56992.1
(760 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59744 similar to UniRef100_A2Q1E3 Cluster: FAD linked... 66 3e-10
>gnl|LJGI|TC59744 similar to UniRef100_A2Q1E3 Cluster: FAD linked oxidase,
N-terminal; n=1; Medicago truncatula|Rep: FAD linked
oxidase, N-terminal - Medicago truncatula (Barrel
medic), partial (25%)
Length = 766
Score = 65.9 bits (33), Expect = 3e-10
Identities = 87/105 (82%)
Strand = Plus / Plus
Query: 487 tcttggactgattacttgtatttgtctgtgggtggaactctgtctaacgcgggtattagt 546
|||||||||||||||||||||||| ||||||| || ||||| || || || || || |||
Sbjct: 587 tcttggactgattacttgtatttgactgtgggagggactctttccaatgctggcataagt 646
Query: 547 ggacaaaccttcaattacggccctcaaatctccaatgttcttgaa 591
|| || || ||||| || || ||||||||| | | ||||||||||
Sbjct: 647 ggccagacattcaaatatggtcctcaaatcacaagtgttcttgaa 691