Miyakogusa Predicted Gene

Lj5g3v2238670.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2238670.1 Non Chatacterized Hit- tr|I1K7N8|I1K7N8_SOYBN
Uncharacterized protein (Fragment) OS=Glycine max
PE=4,68.29,0,FAD_binding_4,FAD linked oxidase, N-terminal; seg,NULL;
PREDICTED: SIMILAR TO L-GULONO-GAMMA-LACTONE,CUFF.56992.1
         (760 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59744 similar to UniRef100_A2Q1E3 Cluster: FAD linked...    66   3e-10

>gnl|LJGI|TC59744 similar to UniRef100_A2Q1E3 Cluster: FAD linked oxidase,
           N-terminal; n=1; Medicago truncatula|Rep: FAD linked
           oxidase, N-terminal - Medicago truncatula (Barrel
           medic), partial (25%)
          Length = 766

 Score = 65.9 bits (33), Expect = 3e-10
 Identities = 87/105 (82%)
 Strand = Plus / Plus

                                                                       
Query: 487 tcttggactgattacttgtatttgtctgtgggtggaactctgtctaacgcgggtattagt 546
           |||||||||||||||||||||||| ||||||| || ||||| || || || || || |||
Sbjct: 587 tcttggactgattacttgtatttgactgtgggagggactctttccaatgctggcataagt 646

                                                        
Query: 547 ggacaaaccttcaattacggccctcaaatctccaatgttcttgaa 591
           || || || ||||| || || ||||||||| | | ||||||||||
Sbjct: 647 ggccagacattcaaatatggtcctcaaatcacaagtgttcttgaa 691