Miyakogusa Predicted Gene

Lj5g3v2237590.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2237590.1 Non Chatacterized Hit- tr|C6TBX7|C6TBX7_SOYBN
Putative uncharacterized protein OS=Glycine max PE=4
S,73.13,4e-19,Q9SXG0_ORYSA_Q9SXG0;,NULL; coiled-coil,NULL,CUFF.56982.1
         (201 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC70723 similar to UniRef100_Q9LZ22 Cluster: F1F0-ATPas...   398   e-111

>gnl|LJGI|TC70723 similar to UniRef100_Q9LZ22 Cluster: F1F0-ATPase inhibitor-like
           protein; n=1; Arabidopsis thaliana|Rep: F1F0-ATPase
           inhibitor-like protein - Arabidopsis thaliana (Mouse-ear
           cress), partial (28%)
          Length = 509

 Score =  398 bits (201), Expect = e-111
 Identities = 201/201 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   atggactcaactagtcgaggtgctttcactcgctgcttcagcgacaaaggcaagattctc 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106 atggactcaactagtcgaggtgctttcactcgctgcttcagcgacaaaggcaagattctc 165

                                                                       
Query: 61  agcgaggaggaacaagccaaggaaaacgtctacatccagaaatgggagagggagaggttg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 166 agcgaggaggaacaagccaaggaaaacgtctacatccagaaatgggagagggagaggttg 225

                                                                       
Query: 121 gagaaacagaagcaacaagctgataaggccagggctgagaaggacaaagattctgccaac 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 226 gagaaacagaagcaacaagctgataaggccagggctgagaaggacaaagattctgccaac 285

                                
Query: 181 aagaaacctggaggagcttaa 201
           |||||||||||||||||||||
Sbjct: 286 aagaaacctggaggagcttaa 306