Miyakogusa Predicted Gene
- Lj5g3v2133800.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2133800.1 Non Chatacterized Hit- tr|I1NFV4|I1NFV4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.22903
PE,88.03,0,WD40,WD40 repeat; WD_REPEATS_1,WD40 repeat, conserved site;
WD40 repeat-like,WD40-repeat-containing ,CUFF.56753.1
(1836 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|TC59696 homologue to UniRef100_Q1SN19 Cluster: WD40-lik... 299 3e-80
gnl|LJGI|TC67966 similar to UniRef100_Q1SN19 Cluster: WD40-like;... 291 8e-78
gnl|LJGI|BP049143 similar to UniRef100_A7PH40 Cluster: Chromosom... 224 2e-57
gnl|LJGI|TC57509 similar to UniRef100_Q1SN19 Cluster: WD40-like;... 94 4e-18
>gnl|LJGI|TC59696 homologue to UniRef100_Q1SN19 Cluster: WD40-like; n=1; Medicago
truncatula|Rep: WD40-like - Medicago truncatula (Barrel
medic), partial (42%)
Length = 885
Score = 299 bits (151), Expect = 3e-80
Identities = 388/467 (83%)
Strand = Plus / Plus
Query: 37 tccacggagcgtggccgcggcattctaatctccggcgaccccaaatccaacaacatcctc 96
||||||||||| |||||||| ||||| |||||||||||||| || |||||| ||| |||
Sbjct: 137 tccacggagcgcggccgcgggattctcatctccggcgacccaaagtccaactccatgctc 196
Query: 97 tactgcaccgcccgctccgtcatcatccgcaacctcgacaaccctctccaagtctccgtc 156
||| || || | | || ||| ||||| |||||| | ||||| |||||||||||||||
Sbjct: 197 tacaccaacggcagatcggtcgtcatcatcaaccttcaaaaccccctccaagtctccgtc 256
Query: 157 tacggcgaacacgcctaccccgtcaccgtcgcccgctactcccccaacggcgagtggatc 216
|| || |||||||||||||| | ||||||||| || | ||||||||||||||||||| ||
Sbjct: 257 tatggggaacacgcctaccctgccaccgtcgctcgattctcccccaacggcgagtgggtc 316
Query: 217 gcctccgccgatgtgtccggcaccgtccgcatctgggggacccacaacgacttcgtcctc 276
|||||||| || |||||||||||| | |||||||| |||| |||||||||||| |
Sbjct: 317 gcctccgctgactcctccggcaccgtcaggatctggggcacccgcaacgacttcgttttg 376
Query: 277 aaaaacgagttccgtgtcctctctagtcggatcgatgatcttcaatggtccgccgatggc 336
|| || ||||||||||||||||| ||||||||||||| |||||||||||| |||||||
Sbjct: 377 aagaaggagttccgtgtcctctccggtcggatcgatgaccttcaatggtcccccgatggt 436
Query: 337 atgaggatcgttgcctctggggatggcaagggcaaatccttcgttcgcgctttcatgtgg 396
| |||||||| |||| || |||| || || ||||| ||||| |||||||||||||||
Sbjct: 437 ctcaggatcgtggcctgcggcgatgctaaagggaaatctttcgtccgcgctttcatgtgg 496
Query: 397 gattcaggctccactgttggtgatttcgatggccattcgcggcgcgttttgagttgtgca 456
|||||||| ||| |||||||| || ||||| ||||| |||| ||||| |||||||||
Sbjct: 497 gattcagggaccaacgttggtgaatttgatggtcattccaggcgagttttaagttgtgca 556
Query: 457 ttcaaaccaacaaggccattccgcattgtctcgtgtggagaggattt 503
| ||||| ||||| || |||||||||||| | ||||||||||||||
Sbjct: 557 tataaaccgacaagacctttccgcattgtcacttgtggagaggattt 603
Score = 61.9 bits (31), Expect = 1e-08
Identities = 70/83 (84%)
Strand = Plus / Plus
Query: 700 ggcagcatatatgctgttagttggagtcctgacagtaaacaggttcttaccgtgtctgct 759
|||||||| ||||||||||| ||||||||||| | ||||| || || || || ||||||
Sbjct: 800 ggcagcatttatgctgttagctggagtcctgatggaaaacaagtgctgactgtatctgct 859
Query: 760 gacaaatctgctaaagtatggga 782
|| || ||||| |||||||||||
Sbjct: 860 gataagtctgcaaaagtatggga 882
>gnl|LJGI|TC67966 similar to UniRef100_Q1SN19 Cluster: WD40-like; n=1; Medicago
truncatula|Rep: WD40-like - Medicago truncatula (Barrel
medic), partial (36%)
Length = 773
Score = 291 bits (147), Expect = 8e-78
Identities = 387/467 (82%)
Strand = Plus / Plus
Query: 37 tccacggagcgtggccgcggcattctaatctccggcgaccccaaatccaacaacatcctc 96
||||||||||| |||||||| ||||| |||||||||||||| || || ||| ||| |||
Sbjct: 146 tccacggagcgcggccgcgggattctcatctccggcgacccaaagtctaactccatgctc 205
Query: 97 tactgcaccgcccgctccgtcatcatccgcaacctcgacaaccctctccaagtctccgtc 156
||| || || | | || ||| ||||| |||||| | ||||| |||||||||||||||
Sbjct: 206 tacaccaacggcagatcggtcgtcatcatcaaccttcaaaaccccctccaagtctccgtc 265
Query: 157 tacggcgaacacgcctaccccgtcaccgtcgcccgctactcccccaacggcgagtggatc 216
|| || |||||||||||||| | ||||||||| || | ||||||||||||||||||| ||
Sbjct: 266 tatggggaacacgcctaccctgccaccgtcgctcgattctcccccaacggcgagtgggtc 325
Query: 217 gcctccgccgatgtgtccggcaccgtccgcatctgggggacccacaacgacttcgtcctc 276
|||||||| || |||||||||||| | |||||||| |||| |||||||||||| |
Sbjct: 326 gcctccgctgactcctccggcaccgtcaggatctggggcacccgcaacgacttcgttttg 385
Query: 277 aaaaacgagttccgtgtcctctctagtcggatcgatgatcttcaatggtccgccgatggc 336
|| || ||||||||||||||||| ||||||||||||| |||||||||||| |||||||
Sbjct: 386 aagaaggagttccgtgtcctctccggtcggatcgatgaccttcaatggtcccccgatggt 445
Query: 337 atgaggatcgttgcctctggggatggcaagggcaaatccttcgttcgcgctttcatgtgg 396
| |||||||| |||| || |||| || || ||||| ||||| |||||||||||||||
Sbjct: 446 ctcaggatcgtggcctgcggcgatgctaaagggaaatctttcgtccgcgctttcatgtgg 505
Query: 397 gattcaggctccactgttggtgatttcgatggccattcgcggcgcgttttgagttgtgca 456
|||||||| ||| |||||||| || ||||| ||||| |||| ||||| |||||||||
Sbjct: 506 gattcagggaccaacgttggtgaatttgatggtcattccaggcgagttttaagttgtgca 565
Query: 457 ttcaaaccaacaaggccattccgcattgtctcgtgtggagaggattt 503
| ||||| ||||| || |||||||||||| | ||||||||||||||
Sbjct: 566 tataaaccgacaagacctttccgcattgtcacttgtggagaggattt 612
>gnl|LJGI|BP049143 similar to UniRef100_A7PH40 Cluster: Chromosome chr17 scaffold_16,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr17 scaffold_16, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (5%)
Length = 500
Score = 224 bits (113), Expect = 2e-57
Identities = 113/113 (100%)
Strand = Plus / Minus
Query: 1724 aaggtgctcatttaggtggagtttatgggttgactttcattgatcaagagagagtggtca 1783
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 500 aaggtgctcatttaggtggagtttatgggttgactttcattgatcaagagagagtggtca 441
Query: 1784 gttcaggagaagatggttgtattcgtgtctggactttaaattctgactgaacg 1836
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440 gttcaggagaagatggttgtattcgtgtctggactttaaattctgactgaacg 388
>gnl|LJGI|TC57509 similar to UniRef100_Q1SN19 Cluster: WD40-like; n=1; Medicago
truncatula|Rep: WD40-like - Medicago truncatula (Barrel
medic), partial (54%)
Length = 1473
Score = 93.7 bits (47), Expect = 4e-18
Identities = 179/223 (80%)
Strand = Plus / Plus
Query: 1375 gatggtagtgaagcaattgttggtggacaagatggtaagttgcacatatattctgtttca 1434
||||| |||||||| ||| |||| ||||| |||||||| ||||| ||||||||| ||||
Sbjct: 533 gatggaagtgaagccattattggcggacaggatggtaaattgcatatatattctatttct 592
Query: 1435 ggagatacatttacagaacagagtgttcttgagaagcaccgaggtgccatcagcgtaatc 1494
|| ||||||||| |||| || ||| || ||||| || | || || || || |||||
Sbjct: 593 ggcgatacatttgaagaagaggctgtcctagagaaacataggggagctattagtgtaatt 652
Query: 1495 agatattctcccgactttaccatgtttgcatctgctgatttgaatcgcgaagctgttgtg 1554
| |||||||| |||||| | ||||||||||| | ||| | ||||| |||||||| |||
Sbjct: 653 cggtattctccagacttttcaatgtttgcatcaggggatgtcaatcgagaagctgtagtg 712
Query: 1555 tgggaccgtgtttccagagaggtgaagctcaacaatatgttgt 1597
|||||||||| ||| |||| |||||||| || ||||||||||
Sbjct: 713 tgggaccgtgcctcccgagatgtgaagcttaagaatatgttgt 755