Miyakogusa Predicted Gene

Lj5g3v2133800.1
Show Alignment: 

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2133800.1 Non Chatacterized Hit- tr|I1NFV4|I1NFV4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.22903
PE,88.03,0,WD40,WD40 repeat; WD_REPEATS_1,WD40 repeat, conserved site;
WD40 repeat-like,WD40-repeat-containing ,CUFF.56753.1
         (1836 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC59696 homologue to UniRef100_Q1SN19 Cluster: WD40-lik...   299   3e-80
gnl|LJGI|TC67966 similar to UniRef100_Q1SN19 Cluster: WD40-like;...   291   8e-78
gnl|LJGI|BP049143 similar to UniRef100_A7PH40 Cluster: Chromosom...   224   2e-57
gnl|LJGI|TC57509 similar to UniRef100_Q1SN19 Cluster: WD40-like;...    94   4e-18

>gnl|LJGI|TC59696 homologue to UniRef100_Q1SN19 Cluster: WD40-like; n=1; Medicago
           truncatula|Rep: WD40-like - Medicago truncatula (Barrel
           medic), partial (42%)
          Length = 885

 Score =  299 bits (151), Expect = 3e-80
 Identities = 388/467 (83%)
 Strand = Plus / Plus

                                                                       
Query: 37  tccacggagcgtggccgcggcattctaatctccggcgaccccaaatccaacaacatcctc 96
           ||||||||||| |||||||| ||||| |||||||||||||| || ||||||  ||| |||
Sbjct: 137 tccacggagcgcggccgcgggattctcatctccggcgacccaaagtccaactccatgctc 196

                                                                       
Query: 97  tactgcaccgcccgctccgtcatcatccgcaacctcgacaaccctctccaagtctccgtc 156
           |||  || || | | || ||| |||||  ||||||  | ||||| |||||||||||||||
Sbjct: 197 tacaccaacggcagatcggtcgtcatcatcaaccttcaaaaccccctccaagtctccgtc 256

                                                                       
Query: 157 tacggcgaacacgcctaccccgtcaccgtcgcccgctactcccccaacggcgagtggatc 216
           || || |||||||||||||| | ||||||||| || | ||||||||||||||||||| ||
Sbjct: 257 tatggggaacacgcctaccctgccaccgtcgctcgattctcccccaacggcgagtgggtc 316

                                                                       
Query: 217 gcctccgccgatgtgtccggcaccgtccgcatctgggggacccacaacgacttcgtcctc 276
           |||||||| ||    |||||||||||| | |||||||| |||| ||||||||||||  | 
Sbjct: 317 gcctccgctgactcctccggcaccgtcaggatctggggcacccgcaacgacttcgttttg 376

                                                                       
Query: 277 aaaaacgagttccgtgtcctctctagtcggatcgatgatcttcaatggtccgccgatggc 336
           || || |||||||||||||||||  ||||||||||||| |||||||||||| ||||||| 
Sbjct: 377 aagaaggagttccgtgtcctctccggtcggatcgatgaccttcaatggtcccccgatggt 436

                                                                       
Query: 337 atgaggatcgttgcctctggggatggcaagggcaaatccttcgttcgcgctttcatgtgg 396
            | |||||||| ||||  || ||||  || || ||||| ||||| |||||||||||||||
Sbjct: 437 ctcaggatcgtggcctgcggcgatgctaaagggaaatctttcgtccgcgctttcatgtgg 496

                                                                       
Query: 397 gattcaggctccactgttggtgatttcgatggccattcgcggcgcgttttgagttgtgca 456
           ||||||||  |||  |||||||| || ||||| |||||  |||| ||||| |||||||||
Sbjct: 497 gattcagggaccaacgttggtgaatttgatggtcattccaggcgagttttaagttgtgca 556

                                                          
Query: 457 ttcaaaccaacaaggccattccgcattgtctcgtgtggagaggattt 503
           |  ||||| ||||| || |||||||||||| | ||||||||||||||
Sbjct: 557 tataaaccgacaagacctttccgcattgtcacttgtggagaggattt 603



 Score = 61.9 bits (31), Expect = 1e-08
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 700 ggcagcatatatgctgttagttggagtcctgacagtaaacaggttcttaccgtgtctgct 759
           |||||||| ||||||||||| |||||||||||  | ||||| || || || || ||||||
Sbjct: 800 ggcagcatttatgctgttagctggagtcctgatggaaaacaagtgctgactgtatctgct 859

                                  
Query: 760 gacaaatctgctaaagtatggga 782
           || || ||||| |||||||||||
Sbjct: 860 gataagtctgcaaaagtatggga 882


>gnl|LJGI|TC67966 similar to UniRef100_Q1SN19 Cluster: WD40-like; n=1; Medicago
           truncatula|Rep: WD40-like - Medicago truncatula (Barrel
           medic), partial (36%)
          Length = 773

 Score =  291 bits (147), Expect = 8e-78
 Identities = 387/467 (82%)
 Strand = Plus / Plus

                                                                       
Query: 37  tccacggagcgtggccgcggcattctaatctccggcgaccccaaatccaacaacatcctc 96
           ||||||||||| |||||||| ||||| |||||||||||||| || || |||  ||| |||
Sbjct: 146 tccacggagcgcggccgcgggattctcatctccggcgacccaaagtctaactccatgctc 205

                                                                       
Query: 97  tactgcaccgcccgctccgtcatcatccgcaacctcgacaaccctctccaagtctccgtc 156
           |||  || || | | || ||| |||||  ||||||  | ||||| |||||||||||||||
Sbjct: 206 tacaccaacggcagatcggtcgtcatcatcaaccttcaaaaccccctccaagtctccgtc 265

                                                                       
Query: 157 tacggcgaacacgcctaccccgtcaccgtcgcccgctactcccccaacggcgagtggatc 216
           || || |||||||||||||| | ||||||||| || | ||||||||||||||||||| ||
Sbjct: 266 tatggggaacacgcctaccctgccaccgtcgctcgattctcccccaacggcgagtgggtc 325

                                                                       
Query: 217 gcctccgccgatgtgtccggcaccgtccgcatctgggggacccacaacgacttcgtcctc 276
           |||||||| ||    |||||||||||| | |||||||| |||| ||||||||||||  | 
Sbjct: 326 gcctccgctgactcctccggcaccgtcaggatctggggcacccgcaacgacttcgttttg 385

                                                                       
Query: 277 aaaaacgagttccgtgtcctctctagtcggatcgatgatcttcaatggtccgccgatggc 336
           || || |||||||||||||||||  ||||||||||||| |||||||||||| ||||||| 
Sbjct: 386 aagaaggagttccgtgtcctctccggtcggatcgatgaccttcaatggtcccccgatggt 445

                                                                       
Query: 337 atgaggatcgttgcctctggggatggcaagggcaaatccttcgttcgcgctttcatgtgg 396
            | |||||||| ||||  || ||||  || || ||||| ||||| |||||||||||||||
Sbjct: 446 ctcaggatcgtggcctgcggcgatgctaaagggaaatctttcgtccgcgctttcatgtgg 505

                                                                       
Query: 397 gattcaggctccactgttggtgatttcgatggccattcgcggcgcgttttgagttgtgca 456
           ||||||||  |||  |||||||| || ||||| |||||  |||| ||||| |||||||||
Sbjct: 506 gattcagggaccaacgttggtgaatttgatggtcattccaggcgagttttaagttgtgca 565

                                                          
Query: 457 ttcaaaccaacaaggccattccgcattgtctcgtgtggagaggattt 503
           |  ||||| ||||| || |||||||||||| | ||||||||||||||
Sbjct: 566 tataaaccgacaagacctttccgcattgtcacttgtggagaggattt 612


>gnl|LJGI|BP049143 similar to UniRef100_A7PH40 Cluster: Chromosome chr17 scaffold_16,
            whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
            Chromosome chr17 scaffold_16, whole genome shotgun
            sequence - Vitis vinifera (Grape), partial (5%)
          Length = 500

 Score =  224 bits (113), Expect = 2e-57
 Identities = 113/113 (100%)
 Strand = Plus / Minus

                                                                        
Query: 1724 aaggtgctcatttaggtggagtttatgggttgactttcattgatcaagagagagtggtca 1783
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 500  aaggtgctcatttaggtggagtttatgggttgactttcattgatcaagagagagtggtca 441

                                                                 
Query: 1784 gttcaggagaagatggttgtattcgtgtctggactttaaattctgactgaacg 1836
            |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 440  gttcaggagaagatggttgtattcgtgtctggactttaaattctgactgaacg 388


>gnl|LJGI|TC57509 similar to UniRef100_Q1SN19 Cluster: WD40-like; n=1; Medicago
            truncatula|Rep: WD40-like - Medicago truncatula (Barrel
            medic), partial (54%)
          Length = 1473

 Score = 93.7 bits (47), Expect = 4e-18
 Identities = 179/223 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1375 gatggtagtgaagcaattgttggtggacaagatggtaagttgcacatatattctgtttca 1434
            ||||| |||||||| ||| |||| ||||| |||||||| ||||| ||||||||| |||| 
Sbjct: 533  gatggaagtgaagccattattggcggacaggatggtaaattgcatatatattctatttct 592

                                                                        
Query: 1435 ggagatacatttacagaacagagtgttcttgagaagcaccgaggtgccatcagcgtaatc 1494
            || |||||||||  |||| ||  ||| || ||||| ||  | || || || || ||||| 
Sbjct: 593  ggcgatacatttgaagaagaggctgtcctagagaaacataggggagctattagtgtaatt 652

                                                                        
Query: 1495 agatattctcccgactttaccatgtttgcatctgctgatttgaatcgcgaagctgttgtg 1554
             | |||||||| |||||| | ||||||||||| |  ||| | ||||| |||||||| |||
Sbjct: 653  cggtattctccagacttttcaatgtttgcatcaggggatgtcaatcgagaagctgtagtg 712

                                                       
Query: 1555 tgggaccgtgtttccagagaggtgaagctcaacaatatgttgt 1597
            ||||||||||  ||| |||| |||||||| || ||||||||||
Sbjct: 713  tgggaccgtgcctcccgagatgtgaagcttaagaatatgttgt 755