Miyakogusa Predicted Gene

Lj5g3v2111920.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2111920.1 Non Chatacterized Hit- tr|I1LEG4|I1LEG4_SOYBN
Uncharacterized protein OS=Glycine max GN=Gma.892 PE=4,82.17,0,Prolyl
4-hydroxylase alpha subunit homologue,Prolyl 4-hydroxylase, alpha
subunit; 2OG-FeII_Oxy,Oxogl,CUFF.56677.1
         (858 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC57562 similar to UniRef100_Q75ZI4 Cluster: Prolyl 4-h...    58   9e-08
gnl|LJGI|TC76330 similar to UniRef100_A7PLM6 Cluster: Chromosome...    52   6e-06

>gnl|LJGI|TC57562 similar to UniRef100_Q75ZI4 Cluster: Prolyl 4-hydroxylase; n=1;
           Nicotiana tabacum|Rep: Prolyl 4-hydroxylase - Nicotiana
           tabacum (Common tobacco), partial (86%)
          Length = 1111

 Score = 58.0 bits (29), Expect = 9e-08
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                        
Query: 724 gatggacttctattttattcattgtttccaaatgggaaaattgat 768
           |||||||||||||||||||||||||| || ||||| | |||||||
Sbjct: 838 gatggacttctattttattcattgttccctaatggtacaattgat 882


>gnl|LJGI|TC76330 similar to UniRef100_A7PLM6 Cluster: Chromosome chr7 scaffold_20,
           whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
           Chromosome chr7 scaffold_20, whole genome shotgun
           sequence - Vitis vinifera (Grape), partial (24%)
          Length = 445

 Score = 52.0 bits (26), Expect = 6e-06
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 721 ggtgatggacttctattttattcattgtttccaaatgg 758
           ||||||||||||||||||||||| ||||| || |||||
Sbjct: 76  ggtgatggacttctattttattccttgttccctaatgg 113