Miyakogusa Predicted Gene

Lj5g3v2098390.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2098390.1 tr|B9I9Y1|B9I9Y1_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_572762 PE=4
SV=1,39.39,0.006,seg,NULL,CUFF.56647.1
         (202 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|FS335722 similar to UniRef100_Q9M2X1 Cluster: ADP-RIBOS...    98   2e-20
gnl|LJGI|DC593300                                                      82   1e-15

>gnl|LJGI|FS335722 similar to UniRef100_Q9M2X1 Cluster: ADP-RIBOSYLATION FACTOR-like
           protein; n=1; Arabidopsis thaliana|Rep: ADP-RIBOSYLATION
           FACTOR-like protein - Arabidopsis thaliana (Mouse-ear
           cress), partial (35%)
          Length = 501

 Score = 97.6 bits (49), Expect = 2e-20
 Identities = 52/53 (98%)
 Strand = Plus / Minus

                                                                
Query: 1   atgattcttgctttgggtgcaagaggtcccgagtttgattctcggaatgcccc 53
           ||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 300 atgattcttgctttgggtgcaagaggtcccgagttcgattctcggaatgcccc 248


>gnl|LJGI|DC593300 
          Length = 590

 Score = 81.8 bits (41), Expect = 1e-15
 Identities = 50/53 (94%)
 Strand = Plus / Minus

                                                                
Query: 1   atgattcttgctttgggtgcaagaggtcccgagtttgattctcggaatgcccc 53
           |||||||| ||||||||||| |||||||||||||| |||||||||||||||||
Sbjct: 405 atgattctcgctttgggtgcgagaggtcccgagttcgattctcggaatgcccc 353