Miyakogusa Predicted Gene
- Lj5g3v2088320.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2088320.1 tr|B9I9Y1|B9I9Y1_POPTR Predicted protein
OS=Populus trichocarpa GN=POPTRDRAFT_572762 PE=4 SV=1,96,0.000003,
,CUFF.56646.1
(277 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|DC593300 143 6e-34
gnl|LJGI|FS335722 similar to UniRef100_Q9M2X1 Cluster: ADP-RIBOS... 141 3e-33
gnl|LJGI|DC597350 homologue to UniRef100_A7PRT8 Cluster: Chromos... 54 5e-07
>gnl|LJGI|DC593300
Length = 590
Score = 143 bits (72), Expect = 6e-34
Identities = 72/72 (100%)
Strand = Plus / Minus
Query: 153 gggcatttggtctagtggtatgattctcgctttgggtgcgagaggtcccgagttcgattc 212
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 424 gggcatttggtctagtggtatgattctcgctttgggtgcgagaggtcccgagttcgattc 365
Query: 213 tcggaatgcccc 224
||||||||||||
Sbjct: 364 tcggaatgcccc 353
>gnl|LJGI|FS335722 similar to UniRef100_Q9M2X1 Cluster: ADP-RIBOSYLATION FACTOR-like
protein; n=1; Arabidopsis thaliana|Rep: ADP-RIBOSYLATION
FACTOR-like protein - Arabidopsis thaliana (Mouse-ear
cress), partial (35%)
Length = 501
Score = 141 bits (71), Expect = 3e-33
Identities = 86/91 (94%)
Strand = Plus / Minus
Query: 141 tcatctaagcttgggcatttggtctagtggtatgattctcgctttgggtgcgagaggtcc 200
|||||| |||||||||||||||| ||||||||||||||| ||||||||||| ||||||||
Sbjct: 331 tcatctcagcttgggcatttggtttagtggtatgattcttgctttgggtgcaagaggtcc 272
Query: 201 cgagttcgattctcggaatgccccaattttt 231
|||||||||||||||||||||||| ||||||
Sbjct: 271 cgagttcgattctcggaatgcccctattttt 241
>gnl|LJGI|DC597350 homologue to UniRef100_A7PRT8 Cluster: Chromosome chr14
scaffold_27, whole genome shotgun sequence; n=1; Vitis
vinifera|Rep: Chromosome chr14 scaffold_27, whole genome
shotgun sequence - Vitis vinifera (Grape), partial (51%)
Length = 591
Score = 54.0 bits (27), Expect = 5e-07
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 158 tttggtctagtggtatgattctcgctt 184
|||||||||||||||||||||||||||
Sbjct: 29 tttggtctagtggtatgattctcgctt 3