Miyakogusa Predicted Gene
- Lj5g3v2063100.1
BLASTN 2.2.25 [Feb-01-2011]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= Lj5g3v2063100.1 Non Chatacterized Hit- tr|K4BCY7|K4BCY7_SOLLC
Uncharacterized protein OS=Solanum lycopersicum
GN=Sol,45,6e-18,seg,NULL; coiled-coil,NULL,CUFF.57009.1
(1705 letters)
Database: LJGI
47,486 sequences; 32,788,469 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
gnl|LJGI|FS323833 similar to UniRef100_A7QH25 Cluster: Chromosom... 133 4e-30
gnl|LJGI|TC70143 66 8e-10
>gnl|LJGI|FS323833 similar to UniRef100_A7QH25 Cluster: Chromosome chr3 scaffold_95,
whole genome shotgun sequence; n=1; Vitis vinifera|Rep:
Chromosome chr3 scaffold_95, whole genome shotgun
sequence - Vitis vinifera (Grape), partial (14%)
Length = 724
Score = 133 bits (67), Expect = 4e-30
Identities = 118/135 (87%)
Strand = Plus / Plus
Query: 21 taggaaccctaggtccaaaggcatcaaggtaaaacatattctgcaaattgttctgttgct 80
|||||||| |||||||||||||||||||| || ||| ||||||| ||| ||||||||||
Sbjct: 152 taggaaccaaaggtccaaaggcatcaaggtcaagcatgttctgcagattattctgttgct 211
Query: 81 tggtatttgcttctggttgatctatcaggttaagcacaatcgtggtaggaaaaaggaatt 140
|||| |||||||||||||||||||||||||||||| | || || || ||| ||||||||
Sbjct: 212 tggtgtttgcttctggttgatctatcaggttaagcgctctcatgataagaagaaggaatt 271
Query: 141 tgatgagaatgatgc 155
|||| ||| ||||||
Sbjct: 272 tgatcagactgatgc 286
>gnl|LJGI|TC70143
Length = 689
Score = 65.9 bits (33), Expect = 8e-10
Identities = 54/61 (88%)
Strand = Plus / Plus
Query: 1627 gaggttcgaactgatctcgatacattgccagatattagaaatgaaggatataatggtgat 1686
||||| |||||||||| |||| ||||||||||||||||||| |||| |||||||||||
Sbjct: 437 gaggtccgaactgatcctgataggttgccagatattagaaatgtaggagataatggtgat 496
Query: 1687 g 1687
|
Sbjct: 497 g 497