Miyakogusa Predicted Gene

Lj5g3v2057330.1
Show Alignment:  

BLASTN 2.2.25 [Feb-01-2011]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= Lj5g3v2057330.1 Non Chatacterized Hit- tr|I1LE59|I1LE59_SOYBN
Uncharacterized protein OS=Glycine max PE=3 SV=1,80.45,0,MFS,Major
facilitator superfamily domain; MFS general substrate
transporter,Major facilitator superf,CUFF.56561.1
         (801 letters)

Database: LJGI 
           47,486 sequences; 32,788,469 total letters

Searching..................................................done



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gnl|LJGI|TC62731 similar to UniRef100_Q94AZ2 Cluster: Sugar tran...    72   6e-12
gnl|LJGI|CB826753 similar to UniRef100_Q9STA8 Cluster: Hexose tr...    68   9e-11

>gnl|LJGI|TC62731 similar to UniRef100_Q94AZ2 Cluster: Sugar transport protein 13;
           n=1; Arabidopsis thaliana|Rep: Sugar transport protein
           13 - Arabidopsis thaliana (Mouse-ear cress), partial
           (65%)
          Length = 1212

 Score = 71.9 bits (36), Expect = 6e-12
 Identities = 117/144 (81%)
 Strand = Plus / Plus

                                                                       
Query: 406 ctcattattggcaggatcatactgggtttcggtgttggtttcgcaaatcaggctgtgcca 465
           |||||| ||||||||||  |||| ||||  ||||||||||| || |||||||| ||||| 
Sbjct: 575 ctcattgttggcaggattttacttggttgtggtgttggttttgccaatcaggcggtgccg 634

                                                                       
Query: 466 gtgtttctttctgagattgctcccaccagaattcgtggtgcactcaacattctcttccag 525
            |||| || ||||| || || ||  | ||||||||||| ||| | || ||||| ||||||
Sbjct: 635 ttgttcctctctgaaatcgcaccttcaagaattcgtggagcattgaatattctgttccag 694

                                   
Query: 526 ttgaatgtcaccattggaattctc 549
            | ||| |||||||||||||||||
Sbjct: 695 ctcaatatcaccattggaattctc 718


>gnl|LJGI|CB826753 similar to UniRef100_Q9STA8 Cluster: Hexose transporter; n=1;
           Solanum lycopersicum|Rep: Hexose transporter - Solanum
           lycopersicum (Tomato) (Lycopersicon esculentum), partial
           (21%)
          Length = 481

 Score = 67.9 bits (34), Expect = 9e-11
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 79  tgcataatggccgccaccggcggccttatgtttggttatgatgttggaatttcaggtggt 138
           ||||| ||||| |||||||| || || |||||||| |||||||||||  ||||||| |||
Sbjct: 206 tgcatcatggctgccaccggaggtctcatgtttggatatgatgttggtgtttcaggcggt 265

                         
Query: 139 gtgacatcaatgcc 152
           |||||||| |||||
Sbjct: 266 gtgacatccatgcc 279